Изучение особенностей первичной структуры генома вакцинного штамма вируса табачной мозаики V-69 тема диссертации и автореферата по ВАК РФ 03.00.15, кандидат биологических наук Снегирева, Полина Борисовна

• Снегирева, Полина Борисовна
• кандидат биологических наук
• 1999

Оглавление диссертации кандидат биологических наук Снегирева, Полина Борисовна

СОДЕРЖАНИЕ

Стр.

1. ВВЕДЕНИЕ

2. ОБЗОР ЛИТЕРАТУРЫ

2.1. Организация генома ВТМ

2.1.1. Геном ВТМ содержит три открытые рамки считывания

2.1.2. Структура концевых некодирующих участков генома

2.1.3. Субгеномные мРНК

2.1.4. Сборка вирусных частиц

2.2. Репликация и синтез вирусных белков

2.3. Ближний транспорт ВТМ

2.3.1. Плазмодесмы в системе межклеточного транспорта растения

2.3.2. Вирусы растений кодируют специальные транспортные белки

2.3.3. Транспортный белок ВТМ

2.3.4. Механизм межклеточного транспорта ВТМ

2.4. Дальний транспорт ВТМ

2.5. Перекрестная защита растений

2.5.1. Феномен перекрестной защиты и успехи ее практического использования

2.5.2. Механизм перекрестной защиты

2.5.3. Молекулярные основы аттенуации вакцинных штаммов

3. МАТЕРИАЛЫ И МЕТОДЫ

3.1. Материалы

3.1.1. Растительный материал

3.1.2. Бактериальные штаммы

3.1.3. Плазмидные векторы

3.1.4. Олигонуклеотидные праймеры

3.1.5. Ферментные препараты

3.1.6. Реактивы и расходные материалы

3.1.7. Среды

3.1.8. Фотоматериалы

3.2. Методы

3.2.1. Получение препарата РНК ВТМ У-69

3.2.1.1. Получение и осветление экстракта

3.2.1.2. Дробное высаливание вирусных частиц

3.2.1.3. Дальнейшая очистка препарата вирусных частиц

3.2.1.4. Выделение геномной РНК BTM V-69

3.2.2. Синтез кДНК генома BTM V-69

3.2.2.1. Получение набора случайных фрагментов кДНК генома BTM V-69

3.2.2.2. Направленный синтез перекрывающихся фрагментов кДНК

с пар специфических праймеров

3.2.3. Встраивание кДНК в вектор

3.2.4. Трансформация бактериальных клеток рекомбинантными плазмидами

3.2.5. Выделение плазмидной ДНК

3.2.6. Полимеразная цепная реакция (ПЦР)

3.2.7. Реакции секвенирования

3.2.7.1. Секвенирование по Максаму и Гилберту

3.2.7.2. Секвенирование по Сэнгеру

3.2.8. Электрофоретическое разделение продуктов реакций секвенирования

в полиакриламидном геле (ПААГ)

3.2.8.1. Приготовление секвенирующего геля

3.2.8.2. Проведение электрофореза

3.2.8.3. Обработка геля после электрофореза

4. РЕЗУЛЬТАТЫ

4.1. Клонирование генома BTM V-69

4.1.1. Клонотека случайных фрагментов кДНК генома BTM V-69

4.1.2. Клонотека перекрывающихся фрагментов кДНК генома BTM V-69

4.2. Нуклеотидная последовательность геномной РНК вакцинного штамма V-69 вируса табачной мозаики

5. ОБСУЖДЕНИЕ

6. ВЫВОДЫ

7. СПИСОК ЛИТЕРАТУРЫ

СПИСОК СОКРАЩЕНИЙ.

ВТМ - вирус табачной мозаики ВОМ - вирус огуречной мозаики ДТ - десмотубула

ЗФБ - зеленый флуоресцентный белок (jellyfish green fluorescent protein)

ПД - плазмодесма

ТБ - транспортный белок

ЭР - эндоплазматический ретикулум

ТРГТС - тРНК-подобная структура

оц-кДНК - одноцепочечная кДНК

дц-кДНК - двухцепочечная кДНК

п.н. - пара нуклеотидов

т.п.н. - тысяч пар нуклеотидов

ПЦР - полимеразная цепная реакция

ПААГ - полиакриламидный гель

ДСН -додецилсульфат натрия

ДТТ - дитиотрейтол

ИПТГ - изопропил-Р-Б-тиогалактозид

ТЕМЕД - М,К,К',М'-тетраметилэтилендиамин

ЭДТА - этилендиаминтетрауксусная кислота

X-gal - 5-бромо-4-хлор-3-индолил-Р-Б-галактозид

Введение диссертации (часть автореферата) на тему «Изучение особенностей первичной структуры генома вакцинного штамма вируса табачной мозаики V-69»

1. ВВЕДЕНИЕ.

АКТУАЛЬНОСТЬ ПРОБЛЕМЫ. Вирусы растений вызывают многочисленные заболевания практически всех экономически важных культур, значительно снижая их урожайность и товарные характеристики (Matthews, 1991). Ежегодные потери от вирусных инфекций оцениваются в несколько тысяч миллионов US$ без учета расходов на проведение защитных мероприятий (Pappu et al., 1995). Вирус табачной мозаики (ВТМ) поражает широкий круг растений-хозяев, в том числе табак, томаты и перец. В результате инфекций ВТМ теряется до 25% урожая тепличных посадок томатов.

Один из способов контроля вирусных заболеваний состоит в защитной вакцинации растений слабопатогенными вирусными изолятами, отбираемыми из природных популяций вируса или получаемыми искусственно путем мутагенеза патогенных форм. Заражение растений вакцинными штаммами делает их устойчивыми к вторичной суперинфекции родственными патогенными вирусами. Несмотря на то, что явление перекрестной защиты известно уже 70 лет (McKinney, 1929), а вакцинация давно и успешно применяется в сельскохозяйственной практике выращивания цитрусовых, томатов, папайи и кабачков (Farinelli and Malnoe, 1996), молекулярные основы ослабления или усиления патогенности вирусов, а также механизмы перекрестной защиты исследованы слабо. Глубокое изучение данных механизмов, которое впрочем, выходит за рамки представленной диссертационной работы, возможно, позволит направленно конструировать новые универсальные вакцинные штаммы, которые смогут составить конкуренцию модным сейчас вирусоустойчивым трансгенным растениям.

Объектом данной диссертационной работы являлся природный аттенуированный штамм V-69 вируса табачной мозаики, полученный ранее в нашей лаборатории и используемый для вакцинации томатов. Выбор объекта исследования определялся важными вакцинными характеристиками штамма, такими, как низкая патогенность, значительная генетическая стабильность и высокий защитный эффект, выделяющими его среди других известных вакцинных штаммов ВТМ.

ЦЕЛЬ И ЗАДАЧИ ИССЛЕДОВАНИЯ. Целью данной диссертационной работы было на примере вакцинного штамма У-69 ВТМ выявить гены или участки генома, мутации в которых определяют ослабление патогенности вируса, и попытаться установить механизмы, обусловливающие явление перекрестной защиты.

Для достижения этой цели были поставлены следующие задачи:

1. Создать клонотеку кДНК геномной РНК вакцинного штамма У-69 ВТМ и осуществить секвенирование полученной клонотеки с целью установления первичной структуры генома ВТМ У-69.

2. Провести сравнительный анализ нуклеотидной последовательности геномной РНК штамма У-69 с последовательностями других известных (в том числе вакцинных) штаммов ВТМ.

2. ОБЗОР ЛИТЕРАТУРЫ.

2.1. Организация генома ВТМ.

2.1.1. Геном ВТМ содержит три открытые рамки считывания.

Вирус табачной мозаики (ВТМ) относится к группе тобамовирусов, насчитывающей в настоящее время, по крайней мере, 15 вирусов (без учета количества штаммов):

1) вирус некротической желтой жилковой мозаики свеклы;

2) вирус мозаики китайской капусты;

3) тобамовирус крестоцветных;

4) вирус зеленой крапчатой мозаики огурцов;

5) вирус кольцевой пятнистости орхидеи;

6) вирус слабой крапчатости паприки;

7) вирус слабой крапчатости перца;

8) вирус мозаики подорожника;

9) вирус мозаики кроталярии;

10) вирус слабой зеленой мозаики табака;

11) вирус табачной мозаики;

12) тобамовирус ОЬ;

13) вирус мозаики томатов;

14) вирус посветления жилок турнепса;

15) вирус опунции Сэммонса (Заттопэ).

Следует отметить, что определенные неудобства вызывает встречающееся в современной литературе параллельное использование синонимичных названий тобамовирусов. Такое дублирование способно привести к искусственному удвоению состава вирусной группы, а также исказить представление о таксономической иерархии внутри группы. Этот вопрос заслуживает особого рассмотрения в связи с тем, что объектом данной работы служил штамм т.н. томатной группы ВТМ, иначе объединяемой под названием вируса мозаики томатов. Мы в настоящей работе при упоминании вирусов этой группы придерживаемся термина "томатный штамм ВТМ" по причине более частого его применения.

Вирусные частицы тобамовирусов содержат геномную однонитевую РНК (т.н.

плюс-РНК), которая служит матрицей для трансляции 5'-концевого гена (Matthews, 1991). Единственная геномная РНК вирусов этой группы содержит три гена, продукты которых обнаруживаются в инфицированных тканях растений. Последовательности генов у ряда представителей группы частично перекрываются (рис.1). Три гена кодируют четыре белка молекулярного веса 126 kDa (126К-белок), 183 kDa (183К-белок), 30 kDa (транспортный белок) и 17.5 kDa (белок оболочки) (рис.1). Коллинеарные белки 126К и 183К транслируются с общего 5'-концевого гена непосредственно с геномной РНК вируса: синтез 126К-белка завершается на внутреннем терминирующем кодоне, а 183К-белок образуется при сквозном прочтении этого терминатора (Pelham, 1978). Белки 126К и 183К необходимы для репликации вирусного генома и являются наиболее консервативными в ряду тобамовирусов (Ishikawa et al., 1986; Ohno et al., 1984). Компьютерный анализ нуклеотидной последовательности выявил в пределах гена 183К дополнительную рамку считывания, продукт трансляции которой (предположительно молекулярного веса 54 kDa) однако не обнаружен (рис.4). Геномная РНК тобамовирусов фланкирована короткими 5'- и 3'-некодирующими последовательностями (рис.1).

Геномная РНК ВТМ (штамма vulgare, так же называемого штаммом U1) состоит из 6395 нуклеотидов. Границы кодирующих последовательностей генов расположены следующим образом (позиции на карте генома ВТМ): 126/183К - 69-4919 (амбер терминатор UAG для 126К в поз. 3417); 30К - 4903-5709; ген белка оболочки - 57126191. Таким образом, конец гена 126/183К перекрывается пятью кодонами с геном транспортного ЗОК-белка, который в свою очередь терминируется за два нуклеотида до начала гена белка оболочки (Goelet et al., 1982) (рис.1).

2.1.2. Структура концевых некодирующих участков генома.

Геномная РНК ВТМ - одна из наиболее эффективно транслируемых природных матриц, как in vivo, так и in vitro, что связано с наличием специфических 3'- и 5'-концевых некодирующих последовательностей. 5'-Некодирующая лидерная последовательность (т.н. Омега) расположена непосредственно перед 126/183К-геном ВТМ и состоит из 68-ми нуклеотидов (поз. 1-68) (рис.1, 2). Впервые она была идентифицирована как устойчивая к действию РНКазы Т1 структура вирусной РНК,

126К/183К

-^^-ЗОК^БО^ 3'

втмь

(6384)

71_

втм

уи^аге (6395)

68_

всзмт

(6355)

70_

взкмо

(6421)

вмк

60_

1143

сс

Л

500 264

сс

500 268

сс

498 256

158

202

15Х

204

У11

158

210

СС

<

ВСКП (6357) 69_ 495

ОЬ (6507) 68_ ¡ШИДмйИ 501

257

156

199

сс

>1Ь

11

4

1б(

26?

<

500

264

сс

К1О

176

283

сс

161

209

Рис.1. Организация геномов тобамовирусов:ВТМ - вирус табачной мозаики, ВСЗМТ - вирус слабой зеленой мозаики табака, ВСКП - вирус слабой крапчатости перца, ОЬ - тобамовирус ОЬ, ВЗКМО - вирус зеленой крапчатой мозаики огурца, ВМК -вирус мозаики кроталярии. Кодирующие области геномов представлены прямоугольниками: 126К/183К - ген репликазы; 30К - ген транспортного белка; БО -ген белка оболочки; З'-и 5'- некодирующие последовательности представлены отрезками прямой; пунктирной линией обозначены несеквенированные области геномов; размеры кодируемых белков указаны в аминокислотных остатках на соответствующих генах, длина некодирующих участков указана в нуклеотидах; сс -сайт начала сборки вируса; 1а, 1Ь, 2 - классификация тобамовирусов по расположению сайта начала сборки (С изменениями из 1кес1а et а1., 1993).

втм -► -► -►

, m7GpppGUAUUUUUACAACAAUUACCAACAACAACAAACAACAAACAACAUUACAAUUACUAUUUACAAUUACAAUG

ВТМ L m7GpppGUAUUUUUACAACAAUUACCAACAACAACAACAAACAACAACAACAUUACAUUUUACAUUCUACAACUACAAUG

ВТМ m7GpppGUA(lJUIJU)ACAACAAUUACCAACAACAACAACAAACAACAA dahlemense

ВСКП m7GpppGUAAAUUUUUCACAAUUUAACAACAACAACACAAACAACAAACAACAUUACAAACAAAAUACAACUACAAUG

B3KMO m7GpppGU(JUUAAUlJUUUAUAAlJUAAACAAACAACAACAACAACAACAAACAAUUUUAAAACAACAAUG

BC3MT m7GpppGAUGUUUUAAUAGUUUUCGACAACAACAAUUAAAACAAAAACAACAUAUUACAAACAACAAACAACAACAAUG

Рис.2. Структура 5'-лидерных (Омега) последовательностей тобамовирусов: ВТМ - вируса табачной мозаики (штаммы: vulgare, L и dahlemense); ВСКП - вируса слабой крапчатости перца, ВЗКМО - вируса зеленой крапчатой мозаики огурца; ВСЗМТ - вируса слабой зеленой мозаики табака. Каждый лидер начинается с гуанозина, несущего кэп-структуру, и заканчивается на стартовом кодонеА1Ю (выделен) для 126/183К-белков. Стрелками указаны прямые восьминуклеотидные повторы, (САА)п-область подчеркнута прямой линией (Из Gallie and Walbot, 1992).

о

четко выявляемая электрофорезом (Matthews, 1991). Первый и единственный гуанозин в составе Омеги (поз. 1) кэпирован (имеет структуру m7GpppG). В первичных структурах 5'-лидеров тобамовирусов выявлены два элемента, определяющие их влияние на эффективность трансляции матрицы: последовательность (САА)п (п=7-10) и прямой повтор ACAAUUAC (рис.2). В геноме ВТМ vulgare две копии повтора фланкируют (САА)п-область справа (поз. 47-54 и 60-67) и одна копия - слева (поз. 1219) (рис.2). Наличие восьминуклеотидных повторов и, в особенности (САА)-мотива, необходимо для функционирования энхансера, но относительное расположение и удаленность друг от друга структурных элементов Омеги не имеют существенного значения (Gallie and Walbot, 1992). Основная роль 5'-лидера заключается в формировании инициирующего дисомного комплекса с рибосомами: одна из рибосом связывается со стартовым AUG-кодоном 126/183К-гена (поз. 69-71), вторая - с AUU-кодоном (поз. 14-16) ближе к 5'-концу геномной РНК вируса. Недавно обнаружен хозяйский белок р102 необходимый для трансляции в клетках растений и специфически связывающийся с (САА)-областью Омеги, а также с З'-некодирующей последовательностью генома ВТМ (Tanguay and Gallie, 1996). В связи с этим полагают, что структурные элементы 5'-лидера вовлечены в специфическое связывание белковых факторов инициации белкового синтеза (Gallie and Walbot, 1992). В составе химерных конструкций Омега усиливает трансляцию как прокариотических так и эукариотических генов in vivo (Gallie et al., 1989; 1991; Gallie and Walbot, 1990) и in vitro (Gallie et al., 1987a, b). Степень повышения экспрессии сильно зависит от источника и концентрации рибосом (Gallie et al., 1988), а также организма-реципиента: она максимальна в клетках двудольных растений (Gallie et al., 1989), умеренна в ооцитах Xenopus laevis (Gallie et al., 1987b), культуре клеток млекопитающих (Gallie et al, 1991) и однодольных растений (Gallie et al., 1989), и не детектируется в дрожжевых клетках (Everett and Gallie, 1992). Влияние лидерной последовательности на стабильность транслируемой матрицы не установлено (Gallie et al., 1989;1991). Получены данные, указывающие на необходимость Омеги для эффективной репликации генома ВТМ (Takamatsu et al., 1991; Watanabe et al., 1996).

Геномные РНК многих вирусов растений на своих 3'-концах содержат аминоацилированные нетранслируемые участки, которые посредством водородных

связей формируют вторичные структуры сходные с L-конформацией тРНК, т.н. тРНК-подобные структуры (ТРПС). Секвенирование этих структур показало, что их тРНК-подобные участки имеют лишь незначительную гомологию с тРНК, лишены модифицированных нуклеотидов и не укладываются в классическую для тРНК модель "клеверного листа". ТРПС узнаются некоторыми тРНК-специфическими ферментами, такими как аминоацил-тРНК-синтетазы, пептидилгидролаза, тРНК-метилтрансфераза, РНКаза Р и нуклеотидилтрансфераза (Metthews, 1991; Haenni and Chapeville, 1997).

З'-Некодирующая последовательность геномной РНК ВТМ (поз. 6192-6395) начинается сразу за геном белка оболочки, состоит из 204-х нуклеотидов и аминоацилирована как правило гистидином (Goelet et al., 1982) (рис.1). Во вторичной структуре З'-некодирующей последовательности ВТМ выявлены два домена: псевдокнотный (поз. 6229-6300) (van Belkum et al., 1985) и тРНК-подобный (поз. 63016395) (Joshi et al., 1985) (рис.3). Последовательность псевдокнотного домена (72 нуклеотида) организована в три псевдокнота, образуемых путем спаривания оснований, принадлежащих петле шпилечной структуры, с основаниями, находящимися в однонитевой области РНК (рис.3).

З'-Некодирующий участок генома ВТМ имеет важное функциональное значение. Во-первых, он специфически узнается вирусной репликазой для инициации синтеза минус-цепи (Ishikawa et al., 1988; Takamatsu et al., 1990; Osman and Buck, 1996). Для размножения вируса критическое значение имеет сохранность сегмента I ближайшего к тРНК-подобному домену третьего псевдокнота (Takamatsu et al., 1990) (рис.3). Во-вторых, З'-некодирующая последовательность ВТМ обеспечивает стабильность геномной и субгеномных РНК вируса, а также увеличивает эффективность их трансляции, действуя аналогично полиА-концам эукариотических мРНК. З'-Некодирующий участок генома ВТМ способен in vitro функционально замещать полиА-концы эукариотических мРНК: его присоединение к 3'-концам неполиаденилированных мРНК усиливает трансляцию матрицы в 100 раз (Gallie and Walbot, 1990). Установлено, что ведущую роль в функционировании З'-некодирующей последовательности в качестве энхансера трансляции играет ее псевдокнотный домен: удаление ТРПС при сохранении псевдокнотного домена лишь незначительно (не более чем в 2 раза) снижает экспрессию мРНК, в то время как ТРПС в отсутствии псевдокнотного домена не обладает каким-либо выраженным стимулирующим

. 6360 АЦ I А иССС-с • •• •

С АШЬ

ии

Г-ии-1

6380

-ссо

. и

и» • • • •

>-ссс—сссс-

СССССССА,

он

—(.1.1.1. -1 -САА ^

-АААиАи-6200

иии

III

—ААА-1

СЦАААА 6220

-иии-1

-

—б-

-сиси

ММ

-САСА-

ГССА • • •

-сси-'

»■АиА 6240

1

исслио-1

м*м

АССиАС-

6340

I

иииии-1 гвиААААААА-

6260

гисАс- -с-иссс-' I—САСССЛ—

» • • • • «III •••••»

-Асис-'гб Лссв-иА-сиоисип

А

11АААиС

и А ^и А ,-Ь А /С I, С у //А ,','А А /// С

. П Ц / У'А

А-и \\Ч\ , А.у /'// С«5 А,и III и-А //// с>2

А.ц NNN4 III С'С1,11 С'в

-Аддиди сиАЛААСАСАСбио лаюшши ил-6200 6250

8

Заключение диссертации по теме «Генетика», Снегирева, Полина Борисовна

6. ВЫВОДЫ.

1. Получены две клонотеки кДНК генома вакцинного штамма V-69 вируса табачной мозаики (ВТМ), секвенирование которых позволило установить полную нуклеотидную последовательность геномной РНК ВТМ V-69.

2. Сравнение нуклеотидной последовательности ВТМ V-69 с известными последовательностями других штаммов ВТМ выявило значительную (свыше 99%) гомологию ВТМ V-69 только с томатным штаммом L, что подтверждает принадлежность штамма V-69 к группе томатных штаммов ВТМ.

3. В структуре генома ВТМ V-69 выявлены 38 нуклеотидных замен и делеция одного аденозина в А-кластере З'-некодирующего участка генома вируса относительно патогенного томатного штамма L.

4. Обнаружен полиморфизм в популяции ВТМ V-69, затрагивающий кодирующие области генома вируса.

5. Установлено, что шесть из 38-ми обнаруженных в структуре ВТМ V-69 нуклеотидных замен потенциально вызывают изменения аминокислотных последовательностей кодируемых вирусом белков: пять замен локализованы в 126К- и 183К-белках репликазы (четыре - в пределах общей для 126К и 183К части, одна - в 183К) и одна замена - в белке оболочки вируса.

6. Две аминокислотные замены в 126К- и 183К-белках репликазы ВТМ V-69 соответствуют аминокислотным заменам в родственном томатном штамме Ltal и определяют способность вирусов преодолевать действие гена устойчивости Тт-1.

7. Ни одна из обнаруженных у ВТМ V-69 мутаций по положению не соотносится с мутациями в других вакцинных и аттенуированных штаммах ВТМ, что позволяет говорить, скорее всего, об отсутствии общего механизма ослабления и участия в перекрестной защите изученных вирусов.

БЛАГОДАРНОСТИ.

Автор выражает искреннюю благодарность за поддержку и всестороннюю помощь в осуществлении представленной диссертационной работы своему научному руководителю с.н.с., к.б.н. Шияну Александру Николаевичу, заведующему лабораторией генетики растений, д.б.н., профессору Пухальскому Виталию Анатольевичу, и всему коллективу лаборатории генетики растений.

Список литературы диссертационного исследования кандидат биологических наук Снегирева, Полина Борисовна, 1999 год

СПИСОК ЛИТЕРАТУРЫ.

1. Маниатис, Т., Фрич, Э., Сэмбрук, Дж. Методы генетической инженерии. Молекулярное клонирование. М.: Мир, 1984. 480 с.

2. Сухов, К.С., Подъяпольская, Т.С., Извекова, Л.И., Андреева Э.Н., Вострова, Н.Г., Иванова, Е.С. (1982). Вакцинный штамм вируса табачной мозаики V-69: получение, свойства и практическое применение. Известия АН СССР. Серия биол. 1:113-125.

3. Шиян, А. Н., Мильшина, Н.В., Снегирева, П.Б., Пухальский, В.А. (1994). Изучение первичной структуры вакцинного штамма вируса табачной мозаики V-69. Генетика 30:1626-1629.

4. Acord, B.R., (1996). Availability of determination of nonregulated status for squash line genetically engineered for virus resistance. Federal Register 61: 33485-33486.

5. Alrefai, R.H., and Korban, S.S. (1995). Cross protection against virus diseases in fruit trees. Fruit Varieties J. 49:21-30.

6. Altschuh, D., Lesk, A.M., Bloomer, A.C., and Klug, A. (1987). Correlation of co-ordinated amino acid substitutions with function in viruses related to tobacco mosaic virus. J. Mol. Biol. 193:693-707.

7. Angell, S.H., Davies, C., and Baulcombe, D.C. (1996). Cell-to-cell movement of potato virys X is associated with a change in the size-exclusion limit of plasmadesmata in trichome cells of Nicotiana clevelandii. Virology 216:197-201.

8. Argos, P. (1988). A sequence motif in many polymerases. Nucleic Acids Res. 16:9909-9916.

9. Banerjee, N., Wang, J.-Y., and Zaitlin, M. (1995). A single nucleotide change in the coat protein gene of tobacco mosaic virus is involved in the induction of severe chlorosis. Virology 207:234-239.

10.Bao, Y., Carter, S.A., and Nelson, R.N. (1996). The 126- and 183- kilodalton proteins of tobacco mosaic virus, and not their common nucleotide sequence, control mosaic symptom formation in tobacco. J. Virol. 70:6378-6383.

11. Barrera, I., Schuppli, D., Sogo, J.M., and Webber, H. (1993). Different mechanisms of recognition of bacteriophage Qp plus and minus strand RNAs by QP replicase. J. Mol. Biol. 232:512-521.

12. Baulcombe, D.C. (1996). Mechanisms of pathogen-derived resistance to viruses in transgenic plants. Plant Cell 8:1833-1844.

13.Beachy, R.N., and Zaitlin, M. (1977). Characterization and in vitro translation of the RNAs from less-than-full-length, virus related, nucleoprotein rods present in tobacco mosaic virus preparations. Virology 81:160-169.

14.Beier, H., Barciszewska, M., Krupp, G., Mitnacht, R., and Gross, H.J. (1984). UAG readthrough during TMV RNA translation: isolation and sequence of two tRNATyr with suppressor activity from tobacco plants. EMBO J. 3:351-356.

15.Bendahmane, M., Fitchen, J.H., Zhang, G., and Beachy, R.N. (1997). Studies of coat proteinmediated resistance to tobacco mosaic tobamovirus: correlation between assembly of mutant coat proteins and resistance. J. Virol. 71:7942-7950.

16.Bercovich, J.A., Grinstein, S., and Zorzopulos, J. (1992). Effect of DNA concentration on recombinant plasmid recovery after blunt-end ligation. BioTechniques 12:190-192.

17.Berna, A., Gafny, R„ Wolf, S., Lucas, W„ Holt, C.A., and Beachy, R.N. (1991). The TMV movement protein: role of the C-terminal 73 amino acids in subcellular localization and function. Virology 182:682-689.

18. Blackman, L.M., Boevink, P., Santa Cruz, S., Palukaitis, P., and Oparka, K.J. (1998). The movement protein of cucumber mosaic virus traffics into sieve elements in minor veins of Nicotiana clevelandii. Plant Cell 10:525-537.

19.Bleykasten, C., Gilmer, D., Guilley, H., Richards, K., and Jonard, G. (1996). Beet necrotic yellow vein virus 42 kDa triple gene block protein binds nucleic acid in vitro. J. Gen. Virol. 77:889-897.

20.Blum, H., Gross, H.J., and Beier, H. (1989). The expression of the TMV-specific 30-kDa protein in tobacco protoplasts is strongly and selectively enhanced by actinomycin. Virology 169:51-61.

21. Butler, P.J.G., Bloomer, A.C., and Finch, J.G. (1992). Direct visualization of the structure of the 20S aggregate of coat protein of tobacco mosaic virus. J. Mol. Biol. 224:381-394.

22.Calder, V.L., and Palukaitis, P. (1992). Nucleotide sequence analysis of the movement genes of resistance breaking strains of tomato mosaic virus. J. Gen. Virol. 73:165-168.

23.Carrington, J.C., Kasschau, K.D., Mahajan, S.K., and Schaad, M.C. (1996). Cell-to-cell and long-distance transport viruses in plants. Plant Cell 8:1669-1681.

24. Carter, M.J., and Milton, I.D. (1993). An inexpensive and simple method for DNA purification on silica particles. Nucleic Acids Res. 21:1044.

25.Cassels, A.C., and Herrick, C.C. (1977). Cross protection between severe and mild strains of tobacco mosaic virus in doubly infected tomato plants. Virology 78:253-260.

26.Chapman, S., Kavanagh, T., and Baulcombe, D.C. (1992). Potato virus X as a vector for gene expression in plants. Plant J. 2:549-557.

27.Cho, J.J., Ullman, D.E., Wheatley, E., Holly, J., and Gonsalves, D. (1992). Commercialization of ZYMV cross protection for zucchini production in Hawaii. Phytopathology 82:1073.

28.Citovsky, V., Knorr, D., Schuster, G., and Zambryski, P. (1990). The P30 movement protein of tobacco mosaic virus is a single-strand nucleic acid binding protein. Cell 60:637-647.

29.Citovsky, V., Knorr, D., and Zambryski, P. (1991). Gene I potential cell-to-cell movement locus of cauliflower mosaic virus, encodes an RNA-binding protein. Proc. Natl. Acad. Sci. USA 88: 2476-2480.

30.Citovsky, V., McLean. B.G., Zupan, J.P., and Zambryski, P. (1993). Phosphorylation of tobacco mosaic movement protein by a developmentally regulated plant cell wall-associated protein kinase. Genes Dev. 7:904-910.

Sl.Citovsky, V., Wong, M.L., Show, A., Prasad, B.V.V., and Zambryski, P. (1992). Vizualization and characterization of tobacco mosaic movement protein binding to single-stranded nucleic acids. Plant Cell 4:397-411.

32.Clark, W.G., Fitchen, J.H., Nejidat, A., Deom, C.M., and Beachy, R.N. (1995a). Studies of coat protein-mediated resistance to tobacco mosaic virus (TMV). II. Challenge by a mutant with altered virion surface does not overcome resistance conferred by TMV coat protein. J. Gen. Virol. 76:2613-2617.

33.Clark, W.G., Fitchen, J.H., and Beachy, R.N. (1995b). Studies of coat protein-mediated resistance to TMV. I. The PM2 assembly defective mutant confers resistance to TMV. Virology 208:485-491.

34.Cleland, R.E., Fujiwara, T., and Lucas, W.J. (1994). Plasmodesmatal-mediated cell-to-cell transport in wheat roots is modulated by anerobic stress. Protoplasma 178:81-85.

35.Cooper, B., and Dodds, J.A. (1995). Differences in the subcellular localization of tobacco mosaic virus and cucumber mosaic virus movement proteins in infected and transgenic plants. J. Gen. Virol. 76:3217-3221.

36.Cooper, B., Lapidot, M., Heick, J.A., Dodds, J.A., and Beachy, R.N. (1995). A defective movement protein of TMV in transgenic plants confers resistance to multiple viruses whereas the functional analog increases susceptibility. Virology 206:307-313.

37.Cooper, B., Schmitz, I., Rao, A.L.N., Beachy, R.N., and Dodds, J.A. (1996). Cell-to-cell transport of movement-defective cucumber mosaic and tobacco mosaic viruses in transgenic plants expressing heterologous movement protein genes. Virology 216:208-213.

38.Corsini, D.L., Pavek, J.J., Martin, M.W., and Brown, C.R. (1994). Potato germplasm with combined resistance to leafroll virus and viruses X and Y. Amer. Potato J. 71:377-385.

39.Costa, A.S., and Muller, G.W. (1980). Tristeza control by cross protection: a US - Brazil cooperative success. Plant Disease 64:538-541.

40.Cronin, S., Verchot, J., Haldeman-Cahill, R., Schaad, M.C., and Carrington, J.C. (1995). Long-distance movement factor: A transport function of the potyvirus helper component proteinase. Plant Cell 7:549-559.

41.Culver, J.N. (1996). Tobamovirus cross protection using a potexvirus vector. Virology 226:228-235.

42.Culver, J.N., Lehto, K., Close, S.M., Hilf, M.E., and Dawson, W.O. (1993). Genomic position affects the expression of tobacco mosaic virus movement and coat protein genes. Proc. Natl. Acad. Sci. USA 90:2055-2059.

43. Culver, J.N., Stubbs, G., and Dawson, W.O. (1994). Structure-function relationship between tobacco mosaic virus coat protein and hypersensitivity in Nicotiana sylvestris. J. Mol. Biol. 242:130-138.

44. Dawson, W.O. (1992). Tobamovirus - plant interactions. Virology 186:359-367.

45.Dawson, W.O., Bubrick, C., and Grantham, G.L. (1988). Modifications of the tobacco mosaic virus coat protein gene affecting replication, movement, and symptomatology. Phytopathology 78:783-789.

46.Dawson, W.O., Lewandowski, D.J., Hilf, M.E., Bubrick, P., Raffo, A.J., Shaw, J.J., Grantham, G.L., and Desardins, P.R. (1989). A tobacco mosaic virus-hybrid expresses and loses an added gene. Virology 172:285-292.

47.De Franco, C., Chicurel, M.E., and Potter, H. (1998). A general RNA-binding protein complex that includes the cytosceleton-associated protein MAP1A. Mol. Biol, of the Cell 9:16951708.

48.Deom, C.M., and He, X.Z. (1997). Second-site reversion of a dysfunctional mutation in a conserved region of the tobacco mosaic tobamoviras movement protein. Virology 232:13-18.

49.Deom, C.M., He, X.Z., Beachy, R.N., and Weissinger, A.K. (1994). Influence of heterologous tobamovirus movement protein and chimeric-movement protein genes on cell-to-cell and longdistance movement. Virology 205:198-209.

50.Deom, C.M., Lapidot, M., and Beachy, R.N. (1992). Plant virus movement proteins. Cell 69:221-224.

51.Deom, C.M., Oliver, M.J., and Beachy, R.N. (1987). The 30K gene product of tobacco mosaic virus potentiates virus movement. Science 237:389-394.

52.Deom, C.M., Schubert,, K.R., Wolf, S„ Holt, C.A., Lucas, W.J., and Beachy, R.N. (1990). Molecular characterization and biological function of the movement protein of tobacco mosaic virus in transgenic plants. Proc. Natl. Acad. Sci. USA 87:3284-3288.

53. Depicker, A., and Van Montagu, M. (1997). Post-transcriptional gene silencing in plants. Curr. Opin. Cell Biol. 9:372-382.

54.DeZoeten, G.A. (1991). Risk assessment do we let history repeat itself? Phytopathology 81:585-586.

55.DeZoeten, G.A., and Fulton, R.W. (1975). Understanding generates possibilities. Phytopathology 65:221-222.

56.DeZoeten, G.A., and Gaard, G. (1984). The presence of viral antigen in the apoplast of systemically virus-infected plants. Virus Res. 1:713-725.

57.Ding, B„ Haudenshield, J.S., Hull, R.J., Wolf, S„ Beachy, R.N., and Lucas, W.J. (1992). Secondary plasmodesmata are specific sites of localization of the tobacco mosaic virus movement protein in transgenic tobacco plants. Plant Cell 4:915-928.

58.Ding, B., Kwon, M.-O., and Warnberg, L. (1996). Evidence that actin filaments are involved in controlling the permeability of plasmadesmata in tobacco mesophyll. Plant J. 10:157-164.

59.Ding, B., Li, Q., Nguyen, L., Palukaitis, P., and Lucas, W.J. (1995). Cucumber mosaic virus 3a protein potentiates cell-to-cell trafficking of CMV RNA in tobacco plants. Virology 207:345353.

60.Ding, B., Turgeon, R., and Parthasarathy, M.V. (1992). Substructure of freeze-substituted plasmodesmata. Protoplasma 169:28-41.

61.Ding, X.S., Shintaku, M.H., Arnold, S.A., and Nelson, R.S. (1995). Accumulation of mild and severe strains of tobacco mosaic virus in minor veins of tobacco. Mol. Plant-Microbe Interact. 8:32-40.

62.Ding, X., Shintaku, M.H., Carter, S.A., and Nelson, R.N. (1996). Invasion of minor veins of tobacco leaves inoculated with tobacco mosaic virus mutants defective in phloem-dependent movement. Proc. Natl. Acad. Sci. USA 93:11155-11160.

63.Dodds, J.A. (1982). Cross-protection and interference between electrophoretically distinct strains of cucumber mosaic virus in tomato. Virology 118:235-240.

64.Dodds, J.A., Lee, S.Q., and Tiffany, M. (1985). Cross Protection between strains of cucumber mosaic virus: effect of host and type of inoculum on accumulation of virions and double-stranded RNA of the challenge strain. Virology 144:301-309.

65.Domingo, E., and Holland, J.J. (1997). RNA virus mutations and fitness for survival. Annu. Rev. Microbiol. 51:151-178.

66.Donald, R.G.K., Petty, I.T.D., Zhou, H., and Jackson, A.O. (1994). Properties of genes influencing barley stripe mosaic virus movement phenotypes. In "Fifth International Symposium on Biotechnology and plant protection: Viral Pathogenesis and Disease Resistance", pp. 135-147.

67.Dorokhov, Y.L., Alexandrova, N.M., Miroshnichenko, N.A., and Atabekov, J.G. (1983). Isolation and analysis of virus-specific ribonucleoprotein of tobacco mosaic virus-infected tobacco. Virology 127:237-252.

68.Dorokhov, Y.L., Alexandrova, N.M., Miroshnichenko, N.A., and Atabekov, J.G. (1984). The informosome-like virus-specific ribonucleoprotein (vRNP) may be involved in the transport of tobacco mosaic virus infection. Virology 137:127-134.

69.Drake, J.W. (1993). Rates of spontaneous mutation among RNA viruses. Proc. Natl. Acad. Sci.USA 90:4171-4175.

70.Everett, J.G., and Gallie, D.R. (1992). RNA delivery in Saccharomyces cerevisiae using electroporation. Yeast 8:1007-1014.

71.FarinelIi, L., and Malnoe, P. (1996). Heterologous encapsidation and recombination in transgenic plants containing viral sequences.

72.Fenczik, C.A., Epel, B.L., and Beachy, R.N. (1996). Role of plasmodesmata and virus movement proteins in spread of plant viruses. In: "Signal transduction in plant growth and development", D.P.S. Verma (ed.), Springer-Verlag, pp. 249-279.

73.Fenczik, C.A., Padgett, H.S., Holt, C.A., Casper, S.J., and Beachy, R.N. (1995). Mutational analysis of the movement protein of odontoglossum ringspot virus to identify a host-range determinant. Mol. Plant-Microbe Interact. 8:666-673.

74.Ferreira, S., Mau, R.F.L., Manshardt, R., Pitz, K.Y., and Gonsalves, D. (1993). Field evaluation of papaya ringspot virus cross protection. Proceedings of the 28th Annual Hawaii Papaya Industry Association Conference, pp. 14-19.

75.Fitchen, J.H., and Beachy, R.N. (1993). Genetically engineered protection against viruses in transgenic plants. Annual Review of Microbiology 47:739-763.

76.Fuchs, M., Ferreira, S., and Gonsalves, D. (1997). Management of virus diseases by classical and engineered protection. Molecular Plant Pathology On-Line [http:www.bspp.org.uk/mppol/] 1997/0116fuchs.

77.Fujiwara, T., Giesman-Cookmeyer, D., Ding, B., Lommel, S.A., and Lucas, W.J. (1993). Cell-to-cell trafficking of macromolecules through plasmodesmata potentiated by the red clover necrotic mosaic virus movement protein. Plant Cell 5:1783-1794.

78.Fulton, R.W. (1951). Superinfection by strains of tobacco mosaic virus. Phytopathology 41:579-592.

79.Gafny, R., Lapidot, M., Berna, A., Holt, C.A., Deom, C.M., and Beachy, R.N. (1992). Effects of terminal deletion mutations on function of the movement protein of tobacco mosaic virus. Virology 187:499-507.

80.Gallie, D.R. (1996). Translational control of cellular and viral mRNAs. Plant Mol. Biol. 32:145-158.

81 .Gallie, D.R., Feder, J.N., Schimke, R.T., and Walbot, V. (1991). Functional analysis of the tobacco mosaic virus tRNA-like structure in cytoplasmic gene regulation. Nucleic Acids Res. 19:5031-5036.

82.Gallie, D.R., Feder, J.N., Schimke, R.T., and Walbot, V. (1991). Post-transcriptional regulation in higher eukaryotes: the role of the reporter gene in controlling expression. Mol. Gen. Genet. 228:258-264.

83.Gallie, D.R., Lucas, W.J., and Walbot, V. (1989). Visualizing mRNA expression in plant protoplasts: factors influencing efficient mRNA uptake and translation. Plant Cell 1:301-311.

84.Gallie, D.R., Sleat, D.E., Watts, J.W., Turner, P.C., and Wilson, T.M.A.(1987a). The 5'-leader sequence of tobacco mosaic virus RNA enhances the expression of foreign gene transcripts in vitro and in vivo. Nucleic Acids Res. 15:3257-3273.

85.Gallie, D.R., Sleat, D.E., Watts, J.W., Turner, P.C., and Wilson, T.M.A.(1987b). A comparison of eukaryotic viral 5'-leadersequences as enhancers of mRNA expression in vivo. Nucleic Acids Res. 15:8693-8711.

86.Gallie, D.R., Sleat, D.E., Watts, J.W., Turner, P.C., and Wilson, T.M. (1988a). Mutational analysis of the tobacco mosaic virus 5'-leader for altered ability to enhance translation. Nucleic Acids Res. 16:883-893.

87.Gallie, D.R., and Walbot, V. (1990). RNA pseudoknot domain of tobacco mosaic virus can functionally substitute for a poly(A) tail in plant and animal cells. Genes Dev. 4:1149-1157.

88.Gallie, D.R., and Walbot, V. (1992). Identification of the motifs within the tobacco mosaic virus 5'-leader responsible for enhancing translation. Nucleic Acids Res. 20:4631-4638.

89.Gallie, D.R., Walbot, V., and Hershey, J.W. (1988b). The ribosomal fraction mediates the translational enhancement associated with the 5'-leader of tobacco mosaic virus. Nucleic Acids Res. 16:8675-8694.

90.Gera, A., Deom, C.M., Donson, J., Shaw, J.J., Lewandowski, D.J., and Dawson, W.O. (1995). Tobacco mosaic tobamovirus does not require concominant synthesis of movement protein during vascular transport. Mol. Plant-Microbe Interact. 8:784-787.

91.Gerber, M., and Sarkar, S. (1989). The coat protein of tobacco mosaic virus does not play a significant role for cross-protection. J. Phytopathol. 124:323-331.

92.Gibbs, A. (1976). Viruses and plasmadesmata. In Intercellular Communication in Plants: Studies on Plasmadesmata, B.E.S. Gunning and A.W. Robards, eds (Berlin: Springer-Verlag), 149-164.

93.Giesman-Cookmeyer, D., Silver, S., Vaewhongs, A.A., Lommel, S.A., and Deom, C.M. (1995). Tobamovirus and dianthovirus movement proteins are functionally homologous. Virology 213:38-45.

94.Godefroy-Colburn, T., Gagey, M.-J., Berna, A., and Stussi-Garaud, C. (1986). A nonstructural protein of alfalfa mosaic virus in the walls of infected tobacco cells. J. Gen. Virol. 67:2233-2239.

95.Goelet, P., Lomonossoff, G.P., Butler, P.J.G., Akam, M.E., Gait, M.J., and Karn, J. (1982). Nucleotide sequence of tobacco mosaic virus RNA. Proc. Natl. Acad. Sci. USA 79:5818-5822.

96.Gonsalves, D., Chee, P., Prowidenti, R., Seem, R., and Slightom, J.L. (1992). Comparison of coat protein-mediated and genetically-derived resistance in cucumbers to infection by cucumber mosaic virus under field conditions with natural challenge inoculations by vectors. Bio/Technology 10:1562-1570.

97.Gorbalenya, A.E., and Koonin, E.V. (1989). Viral proteins containing the purine NTP-binding sequence pattern. Nucleic Acids Res. 17:8413-8440.

98.Goto, T., and Nemoto, M. (1971). Studies on control of plant virus diseases by interference of attenuated virus. Hokkaido Nat. Agr. Stn. Res. Bull. 99:67-76.

99.Guilley, H., Jonard, G., Richards, K.E., and Hirth, L. (1975a). Sequence of a specifically encapsidated RNA fragment originating from the tobacco mosaic virus coat protein cistron. Eur. J. Biochem. 54:135-144.

100.Guilley, H., Jonard, G., Richards, K.E., and Hirth, L. (1975b). Observations concerning the sequence of two additional specifically encapsidated RNA fragments originating from the tobacco mosaic virus coat protein cistron. Eur. J. Biochem. 54:145-153.

101.Hackland, A.F., Rybicki, E.P., and Thomson, J.A. (1994). Coat protein-mediated resistance in transgenic plants. Arch. Virol. 139:1-22.

102.Haenni, A.-L., and Chapeville, F. (1997). An enigma: the role of viral RNA aminoacylation. Acta Biochimica Polonica 44:827-838.

103.Haley, A., Hunter, T., Kiberstis, P., and Zimmern, D. (1995). Multiple serine phosphorylation sites on the 30 kDa TMV cell-to-cell movement protein synthesized in tobacco protoplasts. Plant J. 8:715-724.

104.Hamamoto, H., Watanabe, Y., Kamada, H., and Okada, Y. (1997). Amino acid changes in the putative replicase of tomato mosaic tobamovirus that overcome resistance in Tm-1 tomato. J. Gen. Virol. 78:461-464.

105.Hamilton, R.I. (1980). Defenses triggered by previous invaders: virus. In: Horsfall, J.G., Cowling, E.B. (eds) Plant Disease: An Advanced Treatise How Plants Defend Themselves, Plant Disease, vol 5. Academic Press New York, pp 279-303.

106.Hamilton, R.I., and Dodds, J.A. (1970). Infection of barly by tobacco mosaic virus in single and mixed infection. Virology 42:266-268.

107.Haseloff, J., Goelet, P., Zimmern, D., Ahlquist, P., Dasgupta, R., and Kaesberg, P. (1984). Striking similarities in amino acid sequence among nonstructural proteins encoded by RNA viruses that have dissimilar genomic organization. Proc. Natl. Acad. Sci. USA 81:4358-4362.

108. Hayes, R.J., and Buck, K.W. (1990). Complete replication of a eukaryotic virus RNA in vitro by a purified RNA-dependent RNA polymerase. Cell 63:363-368.

109.Hilf, M. E., and Dawson, W.O. (1993). The tobamovirus capsid protein functions as a host-specific determinant of long-distance movement. Virology 193:106-114.

110. Hodgman, T.C. (1988). A new superfamily of replicase proteins. Nature 333:22-23.

111.Holt, C.A., and Beachy, R.N. (1991). In vivo complementation of infectious transcripts from mutant tobacco mosaic virus cDNAs in transgenic plants. Virology 181:109-117.

112.Holt, C.A., Hodgson, R.A.J., Coker, F.A., Beachy, R.N., and Nelson R.N. (1990). Characterization of the masked strain of tobacco mosaic virus: identification of the region responsible for symptom attenuation by analysis of an infectious cDNA clone. Mol. Plant-Microbe Interact. 3:417-423.

113.Hull, R. (1990). Non-conventional resistance to viruses in plants - Concepts and risks. In: Gene Manipulation In Plant Improvement II, J.P. Gustafson, ed, pp289-303.

114.Hunter, T.R., Hunt, T., Knowland, J., and Zimmern, D. (1976). Messenger RNA for the coat protein of tobacco mosaic virus. Nature 260:759-764.

115.1keda, R., Watanabe, E., Watanabe, Y., and Okada, Y. (1993). Nucleotide sequence of tobamovirus Ob which can spread systemically in N gene tobacco. J. Gen. Virol. 74:1939-1944. 116. Inoue, H., Nojima, H., and Okayama, H. (1990). High efficiency transformation of Escherichia coli with plasmids. Gene 96:23-28.

117.1shihama, A., and Barbier, P. (1994). Molecular anatomy of viral RNA-directed RNA polymerases. Arch. Virol. 134:235-258.

118.1shikawa, M., Meshi, T., Motoyoshi, F., Takamatsu, N., and Okada, Y. (1986). In vitro mutagenesis of the putative replicase genes of tobacco mosaic virus. Nucleic Acids Res. 14:82918305.

119.1shikawa, M., Meshi, T., Ohno, T., and Okada, Y. (1991). Specific cessation of minus-strand RNA accumulation at an early stage of tobacco mosaic virus infection. J. Virol. 65:861-868.

120.Jones, R.A.C. (1985). Further studies on resistance-breaking strains of potato virus X. Plant Pathology 34:182-189.

121.Jorgensen, R.A., Atkinson, R.G., Forster, R.L.S., and Lucas, W.J. (1998). An RNA-based information superhighway in plants. Science 279:1486-1487.

122.Joshi, R.L., Chapeville, F., and Haenni, A.L. (1985). Conformational requirements of tobacco mosaic virus RNA for aminoacylation and adenylation. Nucleic Acids Res. 13:347-354.

123.Joshi, S., Pleij, C.W.A., Henni, A.L., Chapville, F., and Bosch, L. (1983). The nature of the tobacco mosaic virus intermediate length RNA-2 and its translation. Virology 127:100-111.

124.Kamer, G., and Argos, P. (1984). Primary structural comparison of RNA-dependent polymerases from plant, animal and bacterial viruses. Nucleic Acids Res. 12:7269-7282.

125.Kaplan, I.B., Shintaku, M.H., Li, Q„ Zhang, L„ Marsh, L.E., and Palukaitis, P. (1995). Complementation of movement defective mutants in transgenic tobacco expressing the cucumber mosaic virus movement gene. Virology 209:188-199.

126.Karpova, O.V., Ivanov, K.I., Rodionova, N.P., Dorokhov, YU.L., and Atabekov, J.G. (1997). Nontranslability and dissimilar behavior in plants and protoplasts of viral RNA and movement protein complexes formed in vitro. Virology 230:11-21.

127.Kempers, R., and Van Bel, A.J.E. (1997). Symplasmic connections between sieve element and companion cell in the stem phloem of Vicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta 201:195-201.

128.Kendall, T.L., and Lommel, S.A. (1992). Nucleotide sequence of carnation ringspot dianthovirus RNA-2. J. Gen. Virol. 73:2479-2482.

129.Kiho, Y., and Nishiguchi, M. (1984). Unique nature of an attenuated strain of tobacco mosaic virus: autoregulation. Microbiol. Immunol. 28:589-599.

130.Knorr, D.A., and Dawson, W.O. (1988). A point mutation in the tobacco mosaic virus capsid protein gene induces hypersensitivity in Nicotiana sylvestris . Proc. Natl. Acad. Sci. USA 85:170-174.

131.Koonin, E.V., and Dolja, V.V. (1993). Evolution and taxonomy of positive-strand RNA viruses: Implications of comparative analysis of amino acid sequences. Crit. Rev. Biochem. Mol. Biol. 28:375-430.

132.Kosaka, Y., and Fukunishi, T. (1994). Application of cross-protection to the control of black soybean mosaic disease. Plant Dis. 78:339-341.

133.Kwaitkowska, M. (1991). Autoradiographic studies on the role of plasmadesmata in the transport of gibberellin. Planta 183:294-299.

134.Lapidot, M., Gafny, R., Ding, B, Wolf, S., Lucas, W.J., and Beachy, R.N. (1993). A dysfunctional movement protein of tobacco mosaic virus that partially modifies the plasmadesmata and limits virus spread in transgenic plants. Plant J. 4:959-970.

135.Leathers, V., Tanguay, R., Kobayashi, M., and Gallie, D.R. (1993). A phylogenetically conserved sequence within viral 3' untranslated RNA pseudoknots regulates translation. Mol. Cell Biol. 13:5331-5347.

136.Lecoq, H., Lemaire, J.M., and Wipf-Scheibel, C. (1991). Control of zucchini yellow mosaic virus in squash by cross protection. Plant Disease 75:208-211.

137.Lee, R.F., and Rocha-Pena, M.A. (1992). Citrus tristeza virus. In: Disease of Fruit Crops, Plant diseases of international importance, J. Kumar, H.S. Chaube, U.S. Singh, and A.N. Mukhopdhyay, eds, vol. Ill, pp. 226-249.

138.Lehto, K., Bubrick, P., and Dawson, W.O. (1990a). Time course of TMV 30K protein accumulation in intact leaves. Virology 174:290-293.

139.Lehto, K., Grantham, G.L., and Dawson, W.O. (1990b). Insertion of sequences containing the coat protein subgenomic RNA promotor and leader in front of the tobacco mosaic virus 30K ORF delays its expression and causes defective cell-to-cell movement. Virology 174:145-157.

140.Leonard, D.A., and Zaitlin, M. (1982). A temperature-sensitive strain of tobacco mosaic virus defective in cell-to-cell movement generates an altered viral-coded protein. Virology 117:416-424.

141. Lewandowski, D.J., and Dawson, W.O. (1993). A single amino acid change in tobacco mosaic virus replicase prevents symptom production. MPMI 6:157-160.

142.LÍ, R.Q., and Zhang, W.C. (1994). Three dimensional electron microscopy visualization of the cytoskeleton of integument cells and nuclear epidermis of Triticum aestivum. Chin. J. Bot. 6:118-122.

143 .Li, Q., and Palukaitis, P. (1993). Analysis of the binding of cucumber mosaic virus - Fny and tobacco mosaic virus - U1 movement proteins to nucleic acids. Phytopathology 83:1425.

144.LÍ, Q., and Palukaitis, P. (1996). Comparasion of the nucleic acid- and NTP-binding properties of the movement protein of cucumber mosaic cucumovirus and tobacco mosaic tobamovirus. Virology 216:71-79.

145.Lu, B., Stubbs, G., and Culver, J.N. (1998). Coat protein interactions involved in tobacco mosaic tobamovirus cross-protection. Virology 248:188-198.

146.Lucas, W.J., Bouche-Pillon, S., Jackson, D.P., Nguyen, L., Baker, L., Ding, B., and Hake, S. (1995). Selective trafficking of KNOTTED 1 homeodomain protein and its mRNA through plasmodesmata. Science 270:1980-1983.

147.Lucas, W.J., Ding, B„ and Van der Schoot. (1993). New Phytol. 125:435-476.

148.MacKenzie, D.J., and Tremaine, J.H. (1988). Ultrastructural location of non-structural protein 3A of cucumber mosaic virus in infected tissueusing monoclonal antibodies to a cloned chimeric fusion protein. J. Gen. Virol. 69:2387-2395.

149.Malyshenko, S.I., Kondakova, O.A., Taliansky, M.E., and Atabekov, J.G. (1989). Plant virus transport function: Complementation by helper viruses is non-specific. J. Gen. Virol. 70:2751-2757.

150. Matthews, R.E.F. (1991). Plant virology. Academic Press Inc, California.

151. Maxam, A.M., and Gilbert, W. (1977). A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 74:560-564.

152.McKinney, H.H. (1929). Mosaic disease in the Canary Islands, West Africa, and Gibraltar. Journal of Agricultural Research 39:557-578.

153.McLean, B.G., Hempel, F.D., and Zambryski, P.C. (1997). Plant intercellular communication via plasmodesmata. Plant Cell 9: 1043-1054.

154.McLean, B.G., Zupan, J., and Zambryski, P.C. (1995). Tobacco mosaic virus movement protein associates with the cytoskeleton in tobacco cells. Plant Cell 7:2101-2114.

155.Medley, T.L. (1994). Availability of determination of nonregulated status for virus resistant squash. Federal Register 59:64187-64188.

156.Melcher, U. (1990). Similarities between putative transport proteins of plant viruses. J. Gen. Virol. 71:1009-1018.

157. Meshi, T., Ishikawa, M„ Motoyoshi, F„ Semba, K., and Okada, Y. (1986). In vitro transcription of infectious RNAs from full-length cDNAs of tobacco mosaic virus. Proc. Natl. Acad. Sci. USA 83:5043-5047.

158.Meshi, T., Motoyoshi, F., Adachi, A., Watanabe, Y., Takamatsu, N., and Okada, Y. (1988). Two concominant base substitutions in the putative replicase genes of tobacco mosaic virus confer the ability to overcome the effects of tomato resistance gene, Tm-1. EMBO J. 7:15751581.

159.Meshi, T., Ohno, T., Iba, H., and Okada, Y. (1981). Nucleotide sequence of a cloned cDNA copy of TMV (cowpea strain) RNA, including the assembly origin, the coat protein cistron, and the 3' non-coding region. Mol. Gen. Genet. 184:20-25.

160.Meshi, T., Watanabe, Y., Saito, T., Sugimoto, A., Maeda, T., and Okada, Y. (1987). Function of the 30 kd protein of tobacco mosaic virus: involvement in cell-to-cell movement and dispensibility for replication. EMBO J. 6:2557-2563.

161. Meyer, F., Weber, H., and Weissmann, C. (1981). Interactions of Qp replicase with Q{3 RNA. J. Mol. Biol. 153:631-660.

162.Mezitt, L.A., and Lucas, W.J. (1996). Plasmodesmal cell-to-cell transport of proteins and nucleic acids. Plant Molecular Biology 32:251-273.

163.Moser, O., Gagey, M.-J., Godefroy-Colburn, T., Stussi-Garaud, C., Ellwart-Tschurtz, M., Nitschko, H., and Mundry K.-W. (1988). The fate of the transport protein of tobacco mosaic virus in systemic and hypersensitive tobacco hosts. J. Gen. Virol. 69:1367-1373.

164.Motoyoshi, F. (1993). ToMV-resistant transgenic tomato as a material for the first field experiment of genetically engineered plants in Japan. In Vitro Cell. Dev. Biol. 29A:13-16.

165.Mundry, K.W., Watkins, P.A., Ashfield, T., Plaskitt, K.A., Eisele-Walter, S., and Wilson, T.M. (1991). Complete uncoating of the 5' leader sequence of tobacco mosaic virus RNA occurs rapidly and is required to initiate cotranslational virus disassambly in vitro. J. Gen. Virol. 72:769777.

166.Munger, H.M. (1993). Breeding for virus disease resistance in cucurbits. In: Kyle M.M. (ed) Resistance to viral disease of vegetables: genetics and breeding Timber Press Oregon, pp44-60.

167.Namba, K., Pattanayek, R., and Stubbs, G. (1989). Visualization of protein - nucleic acid interactions in a virus. Refined structure of intact tobacco mosaic virus at 2.9 A resolution by X-ray fiber diffraction. J. Mol. Biol. 208:307-325.

168.Nelson, R.S., Li, G., Hodgson, R.A.J., Beachy, R.N., and Shintaku, M.H. (1993). Impeded phloem-dependent accumulation of the masked strain of tobacco mosaic virus. Mol. Plant-Microbe Interact. 6:45-54.

169.Nishiguchi, M., Kikuchi, S., Kiho, Y., Ohno, T., Meshi, T., and Okada, Y. (1985). Molecular basis of plant viral virulence; the complete nucleotide sequence of an attenuated strain of tobacco mosaic virus. Nucleic Acids Res. 13:5585-5590.

170.Nishiguchi, M., Motoyoshi, F., and Oshima, N. (1978). Behaviour of a temperature sensitive strain of tobacco mosaic virus in tomato leaves and protoplasts. J. Gen. Virol. 39:53-61.

171.Nishiguchi, M., and Oshima, N. (1977). Differentiation of tomato strain of tobacco mosaic virus from its attenuated strain by the lesion type. Ann. Phytopathol. Soc. Jpn. 43:55-58.

172.Noueiry, A.O., Lucas, W.J., and Gilbertson, R.L. (1994). Two proteins of a plant DNA virus coordinate nuclear and plasmodesmal transport. Cell 76:925-932.

173.0ffei, S.K., Coffin, R.S., and Coutts, R.H.A. (1995). The tobacco necrosis virus p7a protein is a nucleic acid binding protein. J. Gen. Virol. 76:1493-1496.

174.0gava, M., and Sakai, F. (1984). A messenger RNA for tobacco mosaic virus coat protein in infected tobacco mesophyll protoplasts. II. Time course of its synthesis. Phytopathol. Z. 109:193203.

175.Ohno, T., Aoyagi, M., Yamanashi, Y., Saito, H., Ikawa, I., Meshi, T., and Okada, Y. (1984). Nucleotide sequence of the TMV (tomato strain) genome and comparison with the common strain genome. J. Biochem. 96:1915-1923.

176,Ohno, T., Takamatsu, N.. Meshi, T., Okada, Y., Nishiguchi, M., and Kiho, Y. (1983). Single amino acid substitution in 30K protein of tobacco mosaic virus defective in virus transport function. Virology 131:255-258.

177.Okada, Y., and Ohno, T. (1972). Assembly mechanism of tobacco mosaic virus particle from its ribonucleic acid and protein. Mol. Gen. Genet. 114:205-213.

178. O'Reilly, E.K., Wang, Z., French, R., and Kao, C.C. (1998). Interactions between the structural domains of the RNA replication proteins of plant-infecting RNA viruses. J. Virol. 72:7160-7169.

179.0shima, N. (1975). The control of tomato mosaic disease with attenuated strain of TMV. Rev. Plant Protec. Res. 8:126-135.

180.0sman, T.A.M., and Buck, K.W. (1996). Complete replication in vitro of tobacco mosaic virus RNA by a template-dependent, membrane-bound RNA polymerase. J. Virol. 70:6227-6234. 181. Osman, T.A.M., and Buck, K.W. (1997). The tobacco mosaic virus RNA polymerase complex contains a plant protein related to the RNA-binding subunit of yeast eIF-3. J. Virol. 71:6075-6082.

182.Osman, T.A.M., Ingles, P.J., Miller, S.J., and Buck, K.W. (1991). A spontaneous red clover necrotic mosaic virus mutant with a truncated movement protein. J. Gen. Virol. 72:1793-1800. 183.Osman, T.A.M., Hayes, R.J., and Buck, K.W. (1992). Cooperative binding of the red clover necrotic mosaic virus movement protein to single-stranded nucleic acids. J. Gen. Virol. 73:223227.

184.Osman, T.A.M., Thommes, P., and Buck, K.W. (1993). Localization of a single-stranded RNA-binding domain in the movement protein of red clover necrotic mosaic dianthovirus. J. Gen. Virol. 74:2453-2457.

185.Overall, R.L., and Blackman, L.M. (1996). A model of the macromolecular structure of plasmodesmata. Trends Plant Sci. 1:307-311.

186.Palukaitis, P., and Zaitlin, M. (1984). A model to explain the cross-protection phenomenon shown by plant viruses and viroids. In: Kosuge T., Nester E.W. (eds) Plant-microbe interactions: molecular and genetic perspectives. MacMillan, New York, p. 420.

187.Pappu, H.R., Niblett, C.L., and Lee, R.F. (1995). Application of recombinant DNA technology to plant protection: molecular approaches to engineering virus resistance in crop plants. World Journal of Microbiology & Biotechnology 11:426-437.

188.Pascal, E., Sanderfoot, A.A., Ward, B.M., Medville, R., Turgeon, R., and Lazarowitz, S.G. (1994). The geminivirus BR1 movement protein binds single-stranded DNA and localizes to the cell nucleus. Plant Cell 6:995-1006.

189.Pelham, H.R.B. (1978). Leaky UAG termination codon in tobacco mosaic virus RNA. Nature 272:469-471.

190.Perbal, M.C., Thomas, C.L., and Maule, A.J. (1993). Cauliflower mosaic virus gene I product PI forms tubular structures which extend from the surface of infected protoplasts. Virology 195:281-285.

191. Petty, I.T.D., Edwards, M.C., and Jackson, A.O. (1990). Systemic movement of an RNA plant virus determined by a point substitution in 5' leader sequence. Proc. Natl. Acad. Sci. USA 87:8894-8897.

192.Ponz, F., and Bruening, G. (1986). Mechanisms of resistance to plant viruses. Annu. Rev. Phytopathol. 24:355-381.

193.Powell-Abel, P., Nelson, R.S., De, B., Hoffmann, N., Rogers, S.G., Fraley, R.T., and Beachy, R.N. (1986). Delay of disease development in transgenic plants that express the tobacco mosaic virus coat protein gene. Science 232:738-743.

194.Prasad, B.V.V., and Chiu, W. (1987). Sequence comparison of single-stranded DNA binding proteins and its structural implications. J. Mol. Biol. 193:579-584.

195.Rao, A. L. N., and Grantham, G. L. (1995). A spontaneous mutation in the movement protein gene of brome mosaic virus modulate symptom phenotype in Nicotiana benthamiana. J. Virol. 69:2689-2691.

196.Rast, A.T.B. (1972). M 11-16, an artificial symptomless mutant of tobacco mosaic virus for seedling inoculation of tomato crops. Neth. J. Plant Pathol. 78:110-112.

197. Ratcliff, F., Harrison, B.D., and Baulcombe, D.C. (1997). A similarity between viral defense and gene silencing in plants. Science 276:1558-1560.

198.Register, J.C., III, and Beachy, R.N. (1988). Resistance to TMV in transgenic plants results from interference with an early event in infection. Virology 166:524-532.

199.Reichel, C., and Beachy, R.N. (1998). Tobacco mosaic virus infection induces severe morphological changes of endoplasmic reticulum. Proc. Natl. Acad. Sci. USA 95:11169-11174.

200. Rhagavendra, K., Kelly, J.A., Khairallah, L., and Schuster, T.M. (1988). Structure and function of disk aggregates of the coat protein of tobacco mosaic virus. Biochemistry 27:75837588.

201.Ross, A.F. (1974). Interaction of viruses in the host. Acta Hortic. 36:247-260.

202.Rouleau, M., Smith, R.J., Bancroft, J.B., and Mackie, G.A. (1994). Purification, properties, and subcellular localization of foxtail mosaic potexvirus 26-kDa protein. Virology 204:254-265.

203.Rozanov, M.N., Koonin, E.V., and Gorbalenya, A.E. (1992). Conservation of the putative methyltransferase domain: a hallmark of the "Sindbis-like" supergroup of positive-strand RNA viruses. J. Gen. Virol. 73:2129-2134.

204. Ruiz, M.T., Voinnet, O., and Baulcombe, D.C. (1998). Initiation and maintenance of virus-induced gene silencing. Plant Cell 10:937-946.

205.Saito, T., Hosokawa, D., Meshi, T., and Okada, Y. (1987a). Immunocytochemical localization of the 130K and 180K proteins (putative replicase components) of tobacco mosaic virus. Virology 160:477-481.

206.Saito, T., Imai, Y., Meshi, T., and Okada, Y. (1988). Interviral homologies of the 30K proteins of tobamoviruses. Virology 167:653-656.

207.Saito, T., Meshi, T., Takamatsu, N., and Okada, Y. (1987b). Coat protein gene sequence of tobacco mosaic virus ecodes a host response determinant. Proc. Natl. Acad. Sci. USA 84:60746077.

208.Saito, T., Motoyoshi, F., Maeda, T., Yoshiwoka, S., Watanabe, H., and Okada, Y. (1989a). Mutations in the TMV 30-kD protein gene overcome Tm-2 resistance in tomato. Plant Cell 1:515522.

209.Saito, T., Yamanaka, K., and Okada, Y. (1990). Long-distance movement and viral assembly of tobacco mosaic virus mutants. Virology 176:329-336.

210.Saito, T., Yamanaka, K., Watanabe, Y., Takamatsu, N., Meshi, T., and Okada, T. (1989b). Mutational analysis of the coat protein gene of tobacco mosaic virus in relation to hypersensitive response in tobacco plants with the N' gene. Virology 173:11-20.

211. Sambrook, J., Fritsch, E.F., and Maniatis, T. Molecular cloning. A laboratory manual. N.Y.: Cold Spring Harbor Laboratory Press, 1989. 1626 p.

212.Sanford, J.C., and Johnson, S.A. (1985). The concept of parasite-derived resistance -Deriving resistance genes from the parasite's own genome. Journal of Theoretical Biology 113:395-405.

213. Sanger, F., Nicklen, S., and Coulson, A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467.

214.Santa Cruz, S., Roberts, A.G., Prior, D.A.M., Chapman, S., and Oparka, K.J. (1998). Cell-to-cell and phloem-mediated transport of potato virus X: the role of virions. Plant Cell 10:495510.

215.Sarkar, S., and Smitamana, P. (1981). A proteinless mutant of tobacco mosaic virus: evidence against the role of a viral coat protein for interference. Mol. Gen. Genet. 184:158-159. 216.Schmitz, J., Prufer, D., Rohde, W., and Tacke, E. (1996). Non-canonical translation mechanisms in plants: efficient in vitro and in planta initiation at AUU codons of the tobacco mosaic virus enhancer sequence. Nucleic Acids Res. 24:257-263.

217.Schobert, C., Grossmann, P., Gottschalk, M., Komor, E., Pecsvaradi, A., and Nieden, U.Z. (1995). Sieve-tube exudate from Ricinus communis L. seedlings contains ubiquitin and chaperones. Planta 196:205-210.

218.Schoumacher, F., Erny, D.C., Berna, A., Godefroy-Colburn, T., and Stussi-Garaud, C. (1992). Nucleic acid binding properties of the alfalfa mosaic virus movement protein produced in yeast. Virology 188:896-899.

219.Schoumacher, F., Giovane, C., Mario, M., Pirson, A., Godefroy-Colburn, T., and Berna, A. (1994). Mapping of the RNA-binding domain of the alfalfa mosaic virus movement protein. J. Gen. Virol. 75:3199-3201.

220.Seron, K., and Haenni, A.-L. (1996). Vascular movement of plant viruses. Mol. Plant-Microbe Interact. 9:435-442.

221.Shah, D.M., Rommens, C.M.T., and Beachy, R.N. (1995). Resistance to diseases and insects in transgenic plants: progress and applications to agriculture. TIBTECH 13:362-368.

222.Sherwood, J.L. (1987). Demonstration of the specific involvement of coat protein in tobacco mosaic virus (TMV) cross protection using a TMV coat protein mutant. J. Phytopathol. 118:358362.

223.Sherwood, J.L., and Fulton, R.W. (1982). The specific involvement of coat protein in TMV cross protection. Virology 119:150-158.

224.Shintaku, M. (1991). Coat protein gene sequences of two cucumber mosaic virus strains reveals a single amino acid change correlating with chlorosis induction. J. Gen. Virol. 72:25872589.

225.Shintaku, M.H., Carter, S.A., Bao, Y., and Nelson, R.S. (1996). Mapping nucleotides in the 126-kDa protein gene that control the differential symptoms induced by two strains of tobacco mosaic virus. Virology 221:218-225.

226.Siegel, A., Hari, V., and Kolacz, K. (1978). The effects of tobacco mosaic virus infection on host and virus-specific protein synthesis in protoplasts. Virology 85:494-503. 227.SiegeI, A., Montgomery, V.H.I., and Kolacz, K. (1976). A messenger RNA for coat protein isolated from tobacco mosaic virus infected tissue. Virology 73:363-371.

228.Sjolund, R.D. (1997).The phloem sieve element: A river runs through it. Plant Cell 9:11371146.

229.Sleat, D.E., and Palukaitis, P. (1992). A single nucleotide change within a plant virus satellite RNA alters the host specificity of disease induction. Plant J. 2:43-49. 230.Solovyev, A.G., Zelenina, D.A., Savenkov, E.I., Grdzelishvili, V.Z., Morozov, S.YU., Lesemann, D.-E., Maiss, E., Casper, R., and Atabekov, J.G. (1996). Movement of a barley stripe mosaic virus chimera with a tobacco mosaic virus movement protein. Virology 217:435-441. 231.Stone, R. (1994). Large plots are next test for transgenic crop safety. Science 266:1472-1473. 232.Strating, A. (1996). Availability of determination of nonregulated status for papaya lines genetically engineered for virus resistance. Federal Register 61:48663-48664. 233.Sulzinski, M.A., Gabaro, K.A., Palukaitis, P., and Zaitlin, M. (1985). Replication of tobacco mosaic virus. VII. Characterization of a third subgenomic TMV RNA. Virology 145:132-140. 234.Suzuki, M., Kuwata, S., Kataoka, J., Masuta, C., Nitta, N., and Takanami, Y. (1991). Functional analysis of deletion mutants of cucumber mosaic virus RNA3 using an in vitro transcription system. Virology 183:106-113.

235.Takamatsu, N., Ishikawa, M., Meshi, T., and Okada, Y. (1987). Expression of bacterial chloramphenicol acetyltransferase gene in tobacco plants mediated by tobacco mosaic virus RNA. EMBO J. 6:307-311.

236.Takamatsu, N., Watanabe, Y., Iwasaki, T., Shiba, T., Meshi, T„ and Okada, Y. (1991). Deletion analysis of the 5' untranslated leader sequence of tobacco mosaic virus RNA. J. Virol. 65:1619-1622.

237.Takamatsu, N., Watanabe, Y., Meshi, T., and Okada, Y. (1990). Mutational analysis of the pseudoknot region in the 3' noncoding region of tobacco mosaic virus RNA. J. Virol. 64:36863693.

238.Tanguay, R.L., and Gallie, D.R. (1996). Isolation and characterization of the 102-kilodalton RNA-binding protein that binds to the 5' and 3' translational enhancers of tobacco mosaic virus RNA. J. Biol. Chem. 271:14316-14322.

239.TaraporewaIa, Z.F., and Culver, J.N. (1996). Identification of an elicitor active site within the three-dimensional structure of the tobacco mosaic tobamovirus coat protein. Plant Cell 8:169178.

240.Tennant, P.F., Gonsalves, C., Ling, K.-S., Fitch, M., Manshardt, R., Slightom, J.L., and Gonsalves, D. (1994). Differential protection against papaya ringspot virus isolates in coat protein gene transgenic papaya and classically cross-protected papaya. Phytopathology 84:1359-1369. 241 .Tepfer, M. (1993). Viral genes and transgenic plants. Bio/Technology 11:1125-1129.

242.Terry, B.R., and Robards, A.W. (1987). Hydrodynamic radius alone governs the mobility of molecules through plasmodesmata. Planta 171:145-157.

243.Thomas, C.L., and Maule, A.J. (1995). Identification of the cauliflower mosaic virus movement protein RNA-binding domain. Virology 206:1145-1149.

244.Thomas, C.L., Perbal, C., and Maule, A.J. (1993). A mutation of cauliflower mosaic virus gene I interferes with virus movement but not virus replication. Virology 192:415-421.

245.Tien, P., and Wu, G.S. (1991). Satellite RNA for the biocontrol of plant disease. Advances in Virus Research 39:321-339.

246.Tomenius, K., Clapham, D., and Meshi, T. (1987). Localization by immunogold cytochemistry of the virus-coded 30K protein in plasmadesmata of leaves infected with tobacco mosaic virus. Virology 160:363-371.

247.Tucker, E.B., and Tucker, J.E. (1993). Cell-to-cell selectivity in staminal hairs of Setcreasea purpurea. Protoplasma 174:36-44.

248.Urban, L.A., Sherwood, J.L., Melcher, U. (1988). The use of Arabidopsis thaliana cv. Columbia in plant virus interaction studies. Phytopathology 78:1586.

249.Urban, L.A., Sherwood, J.L., Rezende, J.A.M., and Melcher, U. (1990). Examination of mechanisms of cross protection with non-transgenic plants. In "Recognition and Responce in Plant-Virus Interactions" (R.S.S. Fraser, Ed.), NATO ASI Series, H41:415-426, Springer-Verlag, Berlin, Heidelberg.

250.Valkonen, J.P.T., Xu, Y.S., Rokka, V.M., Pulli, S„ and Pehu, E. (1994). Transfer of resistance to potato leafroll virus, potato virus Y and potato virus X from Solarium brevidens to S. Tuberosum through symmetric and designed asymmetric somatic hybridization. Ann. Appl. Biol. 124:351-362.

251.van Belkum, A., Abrahams, J.P., Pleij, C.W., and Bosch, L. (1985). Five pseudoknots are present at the 204 nucleotides long 3' noncoding region of tobacco mosaic virus RNA. Nucleic Acids Res. 13:7673-7686.

252.van Lent, J., Wellink, J., and Goldbach, R. (1990). Evidence for the involvement of the 58K and 48K proteins in the intercellular movement of cowpea mosaic virus. J. Gen. Virol. 71:219224.

253.Vaquero, C., Turner, A.P., Demangeat, G., Sanz, A., Serra, M.T., Roberts, K., and Garcia-Luque, L. (1994). The 3a protein from cucumber mosaic virus increases the gating capacity of plasmodesmata in transgenic tobacco plants. J. Gen. Virol. 75:3193-3197.

254.Waigmann, E., Lucas, W.J., Citovsky, V., and Zambryski, P. (1994). Direct functional assay for tobacco mosaic virus cell-to-cell movement protein and identification of domain involved in increasing plasmadesmatal permeability. Proc. Natl. Acad. Sci. USA 91:1933-1937.

255.Waigmann, E., and Zambryski, P. (1995). Tobacco mosaic virus movement protein -mediated protein transport between trichome cells. Plant Cell 7:2069-2079.

256.Walkey, D.G.A., Lecoq, H., Collier, R., and Dobson, S. (1992). Studies on the control of zucchini yellow mosaic virus in courgettes by mild strain protection. Plant Pathology 41:762-771.

257.Wang, H.L., Gonsalves, D., Prowidenti, R., and Lecoq, H.L. (1991). Effectiveness of cross protection by a mild strain of zucchini yellow mosaic virus in cucumber melon and squash. Plant Disease 75:203-207.

258.Watanabe, Y., Emori, Y., Ooshika, I., Meshi, T., Ohno, T., and Okada, Y. (1984). Synthesis of TMV-specific RNAs and proteins at the early stage of infection in tobacco protoplasts: Transient expression of the 30K protein and its RNA. Virology 133:18-24.

259.Watanabe, Y., Morita, N., Nishiguchi, M., and Okada, Y., (1987). Attenuated strains of tobacco mosaic virus. Reduced synthesis of a viral protein with a cell-to-cell movement function. J. Mol. Biol. 194:699-704.

260.Watanabe, Y., Ohnishi, J., Saitoh, H., Hosokawa, D., and Okada, Y. (1996). Addition of nucleotides similar to deleted CAA repeats in the 5' non-coding region of tomato mosaic virus RNA following propagation. J. Gen. Virol. 77:2353-2357.

261.Weber, H., and Pfitzner, A.J. (1998). Tm-2(2) resistance in tomato requires recognition of the carboxy terminus of the movement protein of tomato mosaic virus. Mol. Plant Microbe Interact. 11:498-503.

262.Weber, H., Schultze, S., and Pfitzner, A.J.P. (1993). Two amino acid substitutions in the tomato mosaic virus 30-kilodalton movement protein confer the ability to overcome the Tm-22 resistance gene in the tomato. J. Virol. 67:6432-6438.

263.Wen, F., Lister, R.M., and Fattouh, F.A. (1991). Cross-protection among strains of barley yellow dwarf virus. J. Gen. Virol. 72:791-799.

264.White, R.G., Badelt, K., Overall, R.L., and Vesk, M. (1994). Actin associated with plasmadesmata. Protoplasma 180:169-184.

265.WijdeveId, M.M., Goldbach, R.W., Meurs, C., and van Loon, L.C. (1992). Accumulation of the 126 kDa protein of tobacco mosaic virus during systemic infection analysed by immunocytochemistry and ELISA. Arch. Virol. 127:195-207.

266.Wilson, T.M.A. (1984). Cotranslational disassambly of tobacco mosaic virus in vitro. Virology 137:255-265.

267.Wilson, T.M.A. (1993). Strategies to protect crop plants against viruses: pathogen-derived resistance blossoms. Proc. Natl. Acad. Sci. USA 90:3134-3141.

268.Wisniewski, L.A., Powell, P.A., Nelson, R.S., and Beaehy, R.N. (1990). Local and systemic spread of tobacco mosaic virus in transgenic tobacco. Plant Cell 2:559-567.

269.Wolf, S., Deom, C.M., Beachy, R.N., and Lucas, W.J. (1989). Movement protein of tobacco mosaic virus modifies plasmodesmatal size exclusion limit. Science 246:377-279.

270.Wolf, S., Deom, C.M., Beachy, R.N., and Lucas, W.J. (1991). Plasmadesmatal function is probed using transgenic tobacco plants that express a virus movement protein. Plant Cell 3:593604.

271.Wu, X., and Shaw, J.G. (1997). Evidence that a viral replicase protein is involved in the disassambly of tobacco mosaic virus particles in vivo. Virology 239:426-434.

272.Yamafuji, R., Watanabe, Y., Meshi, T., and Okada, Y. (1991). Replication of TMV-L and Ltal RNAs and their recombinants in TMV-resistant Tm-1 tomato protoplasts. Virology 183:99105.

273.Yeh, S.D., and Gonsalves, D. (1984). Evaluation of induced mutants of papaya ringspot virus for control by cross protection. Phytopathology 74:1086-1091.

274. Yeh, S.D., and Gonsalves, D. (1994). Practices and perspective of control of papaya ringspot virus by cross protection. In: Advances in Disease Vector Research. Vol. 10. Springer-Verlag, New-York, Inc. pp. 237-257.

275. Ymer, S. (1991). Heat inactivation of DNA ligase prior to electroporation increases transformation efficiency. Nucleic Acids Res. 19:6960.

276.Yoshida, K., Goto, T., and Iizuka, N. (1985). Attenuated isolates of cucumber mosaic virus produced by satellite RNA and cross protection between attenuated isolates and virulent ones. Ann. Phytopath. Soc. Japan 51:238-242.

277.Zaitlin, M. (1976). Viral cross-protection: more understanding is needed. Phytopathology 66:382-383.

278.Zeyenko, V.V., Ryabova, L.A., Gallie, D.R., and Spirin, A.S. (1994). Enhancing effect of the 3'-untranslated region of tobacco mosaic virus RNA on protein synthesis in vitro. FEBS Lett. 354:271-273.

279.Ziegler-Graff, V., Guilford, P.J., and Baulcombe, D.C. (1991). Tobacco rattle virus RNA-1 29K gene product potentiates viral movement and also affects symptom induction in tobacco. Virology 182:145-155.

1?4

280.Zimmern, D. (1977). The nucleotide sequence at the origin for assembly on tobacco mosaic virus RNA. Cell 11:463-482.

281.Zimmern,.D., and Hunter, T. (1983). Point mutation in the 30K open reading frame of TMV implicated in temperature-sensitive assembly and local lesion spreading of mutant Ni2519. EMBO J. 2:1893-1900.

282.Zinnen, T.M., and Fulton, R.W. (1986). Cross-protection between sunn-hemp mosaic and tobacco mosaic viruses. J. Gen. Virol. 67:1679-1687.