Структурная организация гена нейрогранина человека тема диссертации и автореферата по ВАК РФ 03.00.03, кандидат биологических наук Мерцалов, Илья Борисович

• Мерцалов, Илья Борисович
• кандидат биологических наук
• 2001

Оглавление диссертации кандидат биологических наук Мерцалов, Илья Борисович

1. ВВЕДЕНИЕ.

2. ЛИТЕРАТУРНЫЙ ОБЗОР:

2.1. Сигнальная роль кальция и кальмодулина.

2.2. Особенности структуры кальмодулинсвязывающих доменов.

2.3. Нейромодулин (САР-4 3, П, Р57).

2.4. Нейрогранин (ИСЗ, Р17).

2.5. Функции кальций-независимых кальмодулинсвязывающих белков.

3. МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ.

3.1. Материалы и оборудование.

3.2. Методы исследования.

4. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

4.1. Клонирование кДНК нейрогранина человека.

4.2. Анализ аминокислотной последовательности.

4.3. Клонирование фрагментов геномной ДНК, содержащих кодирующую последовательность гена нейрогранина человека.

4.4. Определение стартовых точек транскрипции гена нейрогранина человека и анализ последовательности фрагмента предполагаемой промоторной области.

4.5. Анализ нуклеотидной базы данных проекта «Геном человека».

4.6. Хромосомная локализация гена нейрогранина человека.

5. ВЫВОДЫ.

Введение диссертации (часть автореферата) на тему «Структурная организация гена нейрогранина человека»

Многие процессы в нервной клетке регулируются ионами кальция, которые являются проводниками внешних сигналов в цитоплазму через глутаматные рецепторы канального типа (NMDA), нейрональные никотиновые ацетилхолиновые рецепторы и потенциал-зависимые кальциевые каналы. Внутри клетки кальций в основном связывается многочисленным семейством кальций-связывающих белков, которые содержат структурный домен, так называемый "EF-hand". Наиболее важным представителем белков этого семейства является кальмодулин. Связанный с кальцием кальмодулин регулирует множество процессов в клетке через различные кальций-кальмодулин-связывающие белки. В основном это белки ферментативного ряда, представляющие собой различные кальций-кальмодулин-зависимые протеинкиназы и фосфатазы. В то же время, известно лишь несколько белков, которые связывают кальмодулин в отсутствие ионов кальция. Наиболее изученными являются нейромодулин (GAP-43), который находится в основном в пресинаптической области аксона нервной клетки, и нейрогранин (RC3), локализованный преимущественно в дендритах в постсинаптической области. Эти белки связывают не заполненный ионами кальция кальмодулин небольшой неструктурированной последовательностью гидрофобных и основных аминокислот, так называемым "IQ''-доменом, который после связывания кальмодулина приобретает конформацию альфа-спирали с амфипатическими свойствами. "IQ''-домены нейромодулина и нейрогранина содержат сайт для фосфорилирования нейрональными протеинкиназами С. Фосфорилирование серина внутри "IQ''-домена препятствует связыванию с ним кальмодулина. Фосфорилирование нейрогранина и нейромодулина in vivo описано при явлении длительного потенциирования (LTP), которое представляет собой модель в изучении процессов обучения и запоминания в головном мозге.

В начале 90-х годов в лаборатории рецепции нейропептидов ИБХ им. М.М. Шемякина и Ю.А. Овчинникова РАН при тотальном скрининге пептидов, выделенных из мозга быка, был идентифицирован новый пептид, состоящий из 30 а.к. остатков, который назвали Р30. Он содержал последовательность "IQ''-домена и обладал высокой степенью гомологии с известным кальций-независимым кальмодулин-связывающим белком - нейромодулином, или GAP-43. Впоследствии оказалось, что этот пептид является фрагментом белка нейрогранина (RC3). На сегодняшний день получена информация о первичной структуре нейрогранинов из различных видов млекопитающих и птиц, определена нуклеотидная последовательность соответствующих кДНК, установлена структура гена нейрогранина крысы. Было также обнаружено, что транскрипционная активность основного промотора гена крысы не обладает нейроспецифичностью. В этой связи представляло большой интерес получить информацию о последовательности гена человека, найти участки гомологии с геном крысы в интронах и предполагаемых промоторных регионах для дальнейшего исследования их значения в регулировании экспрессии гена нейрогранина. Кроме того, фактическая информация о структуре гена нейрогранина человека и локализация его на соответствующей хромосоме позволила бы пополнить базу данных идентифицированных генов человека. Целью настоящей работы являлось клонирование и установление нуклеотидной последовательности кДНК нейрогранина человека, установление его геномной организации и локализация на соответствующей хромосоме. Настоящий обзор посвящен описанию структурных и функциональных особенностей кальмодулин-связывающих белков.

2. ЛИТЕРАТУРНЫЙ ОБЗОР

Заключение диссертации по теме «Молекулярная биология», Мерцалов, Илья Борисович

ВЫВОДЫ:

1. В библиотеке кДНК из мозга человека найдены клоны, содержащие фрагменты кДНК нейрогранина. Установлена нуклеотидная последовательность кДНК длиной 1194 п.н. Кодирующая область составляет 234 п.н. и соответствует а.к. последовательности белка из 78 остатков. Обнаружена высокая гомология а.к. последовательностей нейрогранина человека, быка, козы и крысы.

2. В клонотеке геномной ДНК человека найдено 3 клона, содержащих кодирующую последовательность гена нейрогранина человека. Получена физическая карта локуса нейрогранина размером 12,5 т.п.н. Определена частичная нуклеотидная последовательность гена нейрогранина человека общей протяженностью 6 т.п.н. Определена экзон-интронная структура гена. Обнаружено сходство геномной организации нейрогранина крысы и человека.

3. Установлено, что ген нейрогранина человека имеет несколько стартовых точек транскрипции. В последовательности предполагаемой промоторной области гена нейрогранина человека обнаружены потенциальные регуляторные участки, характерные также для гена нейрогранина крысы: последовательность для связывания репрессора и последовательность, обладающая основной промоторной активностью.

4. С использованием черновых последовательностей из базы данных генома человека и собственных данных о частичной нуклеотидной последовательности фрагментов исследованного локуса нейрогранина получена полная последовательность фрагмента длиной 11157 т.п.н.

5. С помощью флюоресцентной гибридизации in situ ген нейрогранина человека локализован на длинном плече 11-й хромосомы, в области 1 Iq23.3-q24.

Список литературы диссертационного исследования кандидат биологических наук Мерцалов, Илья Борисович, 2001 год

1. Aderem А. (1992) The MARCKS brothers: a family of protein kinase С substrates. Cell. Nov 27;71(5):713-6. Review.

2. Aigner L., и др. (1995) Overexpression of the neural growth-associated protein GAP-43 induces nerve sprouting in the adult nervous system of transgenic mice. Cell. Oct 20;83(2):269-78

3. Aigner L., и др. (1993) Depletion of 43-kD growth-associated protein in primary sensory neurons leads to diminished formation and spreading of growth cones. J Cell Biol. Oct;123(2):417-29.

4. Alvarez-Bolado G, Rodriguez-Sanchez P, Tejero-Diez P, Fairen A, Diez-Guerra FJ. (1996) Neurogranin in the development of the rat telencephalon.

5. Neuroscience, Jul;73(2):565-80

6. Angenstein F, Buchner K, Staak S. (1999) Age-dependent differences in glutamate-induced phosphorylation systems in rat hippocampal slices.

7. Hippocampus ;9(2) : 173 8 5

8. Apel E.D., и др. (1990) Identification of the protein kinase С phosphorylation site in neuromodulin. Biochemistry. Mar 6;29(9):2330-5.

9. Benowitz L.I.,H ^p. (1987) Molecular properties of the growth-associated protein GAP-43 (B-50). J. Neurochem. May;48(5): 1640-7.

10. Berrebi A.S.,h Ap. (1991) Cerebellar Purkinje cell markers are expressed in retinal bipolar neurons. J Comp Neurol. Jun 22;308(4):630-49.

11. Berridge M.J. and Irvine R.F. (1989) Inositol phosphates and cell signalling. Nature 341 197-205.

12. Bernal J, Rodriguez-Pena A, Iniguez MA, Ibarrola N, Munoz A. (1992) Influence of thyroid hormone on brain gene expression. Acta Med. Austriaca;19 Suppl 1:32-5

13. Blaustein M. (1988) Calcium transport and buffering in neurons. Trends Neurosci. 11: 438-443

14. Bray-Ward P., Menniger J., Lieman J., Desai T., Mokady N., Banks A., and Ward D.C. (1996) Integration of cytogenetic, genetic, and physical maps of the human genome by FISH mapping of SEPH YAC clones. Genomics 32, 1-14.

15. Bredt DS, Snyder SH. (1990) Isolation of nitric oxide synthetase, a calmodulin-requiring enzyme. Proc Natl Acad Sci USA. Jan;87(2):682-5.

16. Buelt M.K., Glidden B.J., and Storm D.R. (1994) Regulation of p68 RNA helicase by calmodulin and protein kinase C. J. Biol. Chem. 269, 29367-29370.

17. Bustin and Reeves (1996) High-mobility-group chromosomal proteins: architectural components that facilitate chromatin functions. Prog. Nucleic Acid Res. Mol. Biol. 54, 35100.

18. Carafoli E. (1987) Intracellular calcium homeostasis. Annu. Rev. Biochem. 56: 395-434/

19. Carafoli E. (1992) The plasma membrane calcium pump. Structure, function, regulation. Biochim Biophys Acta. Jul 17;1101(2):266-7.

20. Chakravarthy B, Morley P, Whitfield J. (1999) Ca2+-calmodulin and protein kinase Cs: a hypothetical synthesis of their conflicting convergences on shared substrate domains. Trends Neurosci., Jan;22(l):12-6

21. Chapman E.R., h ap. (1991) Characterization of the calmodulin binding domain of neuromodulin. Functional significance of serine 41 and phenylalanine 42. J Biol Chem., Jan 5;266(1):207-13.

22. Chapman E.R., h £p. (1991) Mutagenesis of the calmodulin binding domain of neuromodulin. Prog Brain Res.; 89: 37-44.

23. Chen K.H., Widem S.G., Wilson S.H., Huang K.P. (1993) Identification of nuclear protein binding element within the rat brain protein kinase Cy promoter that is related to the developmental control of this gene. FEBS Lett., v. 325, 3,210-214.

24. Chen SJ, Sweatt JD, Klann E. (1997) Enhanced phosphorylation of the postsynaptic protein kinase C substrate RC3/neurogranin during long-term potentiation.

25. Brain Res., Feb 28; 749(2): 181-7

26. Chen SJ, Klann E, Gower MC, Powell CM, Sessoms JS, Sweatt JD. (1993) Studies with synthetic peptide substrates derived from the neuronal protein neurogranin reveal structural determinants of potency and selectivity for protein kinase C.

27. Biochemistry, Feb 2; 32(4): 1032-9

28. Chen K.H., Widen S.G., Wilson S.H., and Huang K.P. (1990) J Characterization of the 5'-flanking region of the rat protein kinase C gamma gene.J Biol Chem. Nov 15; 265(32): 19961-5.

29. Cohen RW, Margulies JE, Coulter PM 2d, Watson JB. (1993) Functional consequences of expression of the neuron-specific, protein kinase C substrate RC3 (neurogranin) in Xenopus oocytes. Brain Res., Nov 5;627(1): 147-52

30. Cheney R.E. and Mooseker M.S. (1992) Unconventional myosins. Curr. Opin. Cell Biol. 4, 27-35.

31. Coggins P.J., h ap. (1989) Evidence for a single protein kinase C-mediated phosphorylation site in rat brain protein B-50. J Neurochem. Dec;53(6): 1895-901.

32. Coggins P.J., McLean K, Zwiers H. (1993) Neurogranin, a B-50/GAP-43-immunoreactive C-kinase substrate (BICKS), is ADP-ribosylated. FEBS Lett., Nov 29; 335(1): 109-13

33. Danielson P.E., Watson J.B., Gerendasy D.D., Erlander M.G., Lovenberg T.W.,de Lecea L., Sutcliffe J.G., Frankel W. (1994) Chromosomal mapping of mouse genes expressed selectively within the central nervous system. Genomics 19, 454-461.

34. Davidsson P., Puchades M., Blennow K. (1999) Identification of synaptic vesicle, pre-and postsynaptic proteins in human cerebrospinal fluid using liquid-phase isoelectric focusing.

35. Electrophoresis, Mar;20(3):431-7

36. Deloume J.C., Prichard L., Delatte O., Storm D.R. (1997) The prooncoprotein EWS binds calmodulin and is phosphorylated by proteinkinase C through IQ domain. J Biol Chem. 272, 27369-27377.

37. Deloulme JC, Sensenbrenner M, Baudier J. (1991) A rapid purification method for neurogranin, a brain specific calmodulin-binding protein kinase C substrate.

38. FEBS Lett, Apr. 22;282(1): 183-8

39. Di Luca M., Pastorino L., Raverdino V., De Graan P.N., Caputi A., Gispen W.H., Cattabeni F. (1996) Determination of the endogenous phosphorylation state of B-50/GAP-43 and neurogranin in different brain regions by electrospray mass spectrometry.

40. FEBS Lett., Jul 8;389(3):309-13

41. Domanska-Janik K., Zablocka B., Zalewska T., Zajac H. (1998) Phosphorylation of protein kinase C substrate proteins in rat hippocampal slices-effect of calpain inhibition. Acta. Neurobiol. Exp. (Warsz);58(4):247-52

42. Dowling A.L., Thomas Zoeller R. (2000) Thyroid hormone of maternal origin regulates the expression of RC3/neurogranin mRNA in the fetal rat brain. Brain Res. Mol. Brain Res., Oct 20; 82(1-2): 126-32

43. Enderlin V., Pallet V., Alfos S., Dargelos E., Jaffard R., Garcin H., Higueret P. (1997) Age-related decreases in mRNA for brain nuclear receptors and target genes are reversed by retinoic acid treatment. Neurosci. Lett., Jun 27; 229(2): 125-9

44. Fedorov NB, Pasinelli P, Oestreicher AB, DeGraan PN, Reymarm KG. (1995) Antibodies to postsynaptic PKC substrate neurogranin prevent long-term potentiation in hippocampal CA1 neurons. Eur. J. Neurosci., Apr 1; 7(4): 819-22

45. Felipo V.,h AP- (1993) Inhibitors of protein kinase C prevent the toxicity of glutamate in primary neuronal cultures. Brain Res., Feb 26; 604(1-2): 192-6.

46. Ferris C., Huganir R.L., Supattapone S., and Snyder S.H. (1989) Purified inositol 1,4,5-triphosphate receptor mediates calcium flux in reconstituted lipid vesicles. Nature 342: 87-89.

47. Frank D.A., h ,qp. (1994) CREB: a mediator of long-term memory from mollusks to mammals. Cell., Oct 7;79(l):5-8. Review.

48. Friedberg F. (1990) Species comparison of calmodulin sequence. Protein Seq. Data Anal. 3, 335-337.

49. Friedman L.K., h ap. (1994) Kainate-induced status epilepticus alters glutamate and GABA receptor gene expression in adult rat hippocampus: an in situ hybridization study. J. Neurosci., May; 14 (5 Pt 1): 2697-707

50. Gamby C.,h AP- (1996) Analysis of the role of calmodulin binding and sequestration in neuromodulin (GAP-43) function. J. Biol. Chem., Oct 25; 271(43): 26698-705.

51. George J.M., Siepka S.M.; Submitted (25-APR-1996) to the EMBL/GenBank/DDBJ databases AC: U56726;. Cell & Structural Biology, University of Illinois, 505 S. Goodwin, Urbana, IL 61801, USA

52. Gerendasy D. (1999) Homeostatic tuning of Ca2+ signal transduction by members of the calpacitin protein family. J. Neurosci. Res., Oct 1; 58(1): 107-19

53. Gerendasy D.D., Herron S.R., Jennings P.A., Sutcliffe J.G. (1995) Calmodulin stabilizes an amphiphilic alpha-helix within RC3/neurogranin and GAP-43/neuromodulin only when Ca2+ is absent. J. Biol. Chem., Mar 24;270(12):6741-50

54. Gerendasy DD, Herron SR, Watson JB, Sutcliffe JG. (1994) Mutational and biophysical studies suggest RC3/neurogranin regulates calmodulin availability.

55. J. Biol. Chem., Sep 2;269(35):22420-6

56. Gerendasy DD, Sutcliffe JG. (1997) RC3/neurogranin, a postsynaptic calpacitin for setting the response threshold to calcium influxes. Mol. Neurobiol., Oct;15(2):131-63. Review.

57. Gispen W.H.,h ,n,p. (1985) .Presynaptic localization of B-50 phosphoprotein: the (ACTH)-sensitive protein kinase substrate involved in rat brain polyphosphoinositide metabolism. Brain Res. Mar 4; 328(2): 381-5.

58. Glass C.K., (1994) Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr. Rev., 15: 391-407.

59. Glynne R., Ghandour G., Rayner J., Mack D.H., Goodnow C.C. (2000) B-lymphocyte quiescence, tolerance and activation as viewed by global gene expression profiling on microarrays. Immunol. Rev., Aug; 176: 216-46

60. Gould E, Allan MD, McEwen BS. (1990) Dendritic spine density of adult hippocampal pyramidal cells is sensitive to thyroid hormone. Brain Res., Aug 20; 525(2): 327-9.

61. Grabczyk E., h ^p. (1990) Cloning and characterization of the Rat gene encoding GAP-43. European Journal of Neuroscience, Vol. 2, pp. 822-827

62. Han Y.F., h AP- (1992) Protein phosphatases 1 and 2A dephosphorylate B-50 in presynaptic plasma membranes from rat brain. J. Neurochem., Jul; 59(1): 364-74.

63. Hagen S.G., Larson R.J., Strait K.A., Oppenheimer J.H. (1996) A Prkinje cell protein-2 intronic thyroid response element binds developmentally regulated thyroid receptor-nuclear protein complexes. J. Mol. Neurosci., 7: 245-255.

64. Hiatsune C., h Ap. (1997) Characterization of PKA and PKC phosphorylation of the N-methyl-D-aspartate receptor NR1 subunit using phosphorylation site-specific antibodies. J Biol Chem. 272,20805-20810.

65. Huang K. (1989) The mechanism of protein kinase C activation. Trends Neurosci. 12: 425432.

66. Huang K.P., Huang F.L., Li J., Schuck P., McPhie P. (2000) Calcium-sensitive interaction between calmodulin and modified forms of rat brain neurogranin/RC3. Biochemistry, Jun 20;39(24):7291-9

67. Huang K.P., Huang F.L., Chen H.C. (1993) Characterization of a 7.5-kDa protein kinase C substrate (RC3 protein, neurogranin) from rat brain.

68. Arch. Biochem. Biophys., Sep; 305(2): 570-80

69. Ikura, M., Clore G.M., Gronenborn A.M., Zhu G., Klee C.B., and Bax A. (1992) Solution structure of a calmodulin-target peptide complex by multidimensional NMR. Science 256, 632-638.

70. Igarashi M., h ^p. (1993) Mediation by G proteins of signals that cause collapse of growth cones. Science., Jan 1; 259 (5091): 77-9.

71. Iglesias T., Caubin J., Stunnenberg H.G., Zaballos A., Bernal J., Munoz A. (1996) Thyroid hormone-dependent transcriptional repression of neural cell adhesion molecule during brain maturation. EMBO J., 15: 4307-4316.

72. Ingraham H.A., and Evans G.A. (1986) Characterization of two atypical promoters and alternate mRNA processing in the mouse Thy-1.2 glycoprotein gene.

73. Mol Cell Biol. 1986 Aug;6(8): 2923-2931.

74. Iniguez M.A., De Lecea L., Guadano-Ferraz A., Morte B., Gerendasy D., Sutcliffe J.G., Bernal J. (1996) Cell-specific effects of thyroid hormone on RC3/neurogranin expression in rat brain. Endocrinology, Mar; 137(3): 1032-41

75. Iniguez M.A., Rodriguez-Pena A., Ibarrola N., Morreale de Escobar G., Bernal J. (1992) Adult rat brain is sensitive to thyroid hormone. Regulation of RC3/neurogranin mRNA.

76. J. Clin. Invest., Aug; 90(2): 554-8

77. Iniguez M.A., Rodriguez-Pena A., Ibarrola N., Aguilera M., Munoz A., Bernal J. (1993) Thyroid hormone regulation of RC3, a brain-specific gene encoding a protein kinase-C substrate. Endocrinology, Aug; 133(2): 467-73

78. Izumi R., Yamada T., Yoshikai S., Sasaki H., Hattori M., and Sakaki Y. (1992) Positive and negative regulatory elements for the expression of the Alzheimer's disease amyloid precursor-encoding gene in mouse. Gene. 1992 Mar 15;112(2): 189-195.

79. James M.R., Richard III, C.W., et Al. (1995) A radiation hybrid map of 506 STS markers spanning human chromosome 11. Nature Genetics, v. 8, 70-76

80. Kelly PT. (1991) Calmodulin-dependent protein kinase II. Multifunctional roles in neuronal differentiation and synaptic plasticity. Mol. Neurobiol.,5(2-4): 153-77. Review.

81. Kirino T. (1982) Delayed neuronal death in the gerbil hippocampus following ischemia. Brain Res., May 6; 239(1): 57-69.

82. Kincaid R.L., Vaughan M. (1986) Direct comparison of Ca2+ requirements for calmodulin interaction with and activation of protein phosphatase.

83. Proc Natl Acad Sci U S A., Mar; 83 (5): 1193-7.

84. Klann E, Chen SJ, Sweatt JD. (1993) Mechanism of protein kinase C activation during the induction and maintenance of long-term potentiation probed using a selective peptide substrate. Proc Natl Acad Sci U S A., Sep 15; 90(18): 8337-41

85. Klann E., Chen S.J., Sweatt J.D. (1992) Increased phosphorylation of a 17-kDa protein kinase C substrate (PI7) in long-term potentiation. J. Neurochem., Apr;58(4): 1576-9.

86. Klee C.B. (1991) Concerted regulation of protein phosphorylation and dephosphorylation by calmodulin. Neurochem. Res., Sep; 16(9).T 059-65. Review.

87. Kraner S.D., Chong J.A., Tsay H.J., and Mandel G. (1992) Silencing the type II sodium channel gene: a model for neural-specific gene regulation. Neuron. 1992 Jul;9(l):37-44.

88. LaBate M.E., h Ap. (1989) Selective conservation of GAP-43 structure in vertebrate evolution. Neuron., Sep; 3(3): 299-310.

89. Li J., Pak J.H., Huang F.L., Huang K.P. (1999) N-methyl-D-aspartate induces neurogranin/RC3 oxidation in rat brain slices. J. Biol. Chem., Jan 15; 274(3): 1294-300

90. Li L., Suzuki T., Mori N., and Greengard P. (1993) Identification of a functional silencer element involved in neuron-specific expression of the synapsin I gene. Proc. Natl. Acad. Sci. US A., Feb 15; 90(4): 1460-4.

91. Linden D.J., Routtenberg A. (1989) The role of protein kinase C in long-term potentiation: a testable model. Brain Res. Brain Res. Rev., Jul-Sep; 14(3): 279-96. Review.

92. Liu Y.C., h ap. (1989) Dephosphorylation of neuromodulin by calcineurin. J. Biol. Chem., Aug 5; 264(22): 12800-4.

93. Madison D.V., Malenka R.C., Nicoll R.A. (1991) Mechanisms underlying long-term potentiation of synaptic transmission. Annu. Rev. Neurosci., 14: 379-97. Review.

94. Manalan A.S., Krinks M.H., Klee C.B. (1984) Calcineurin: a member of a family of calmodulin-stimulated protein phosphatases. Proc. Soc. Exp. Biol. Med., Oct; 177(1): 12-6.

95. Martinez de Arrieta C., Morte B., Coloma A., Bernal J. (1999) The human RC3 gene homolog, NRGN contains a thyroid hormone-responsive element located in the first intron. Endocrinology, Jan;140(l):335-43

96. Martinez de Arrieta C., Perez Jurado L., Bernal J., Coloma A. (1997) Structure, organization, and chromosomal mapping of the human neurogranin gene (NRGN). Genomics, Apr 15; 41(2): 243-9

97. Martzen M.R., Slemmon J.R. (1995) The dendritic peptide neurogranin can regulate a calmodulin-dependent target. J. Neurochem., Jan; 64(1): 92-100

98. Matsuda Y., h up. (1996) Comparative genome mapping of the ataxia-telangiectasia region in mouse, rat, and Syrian hamster. Genomics, 34, 347-352.

99. Matsuoka Y., Hughes C.A., Bennett V. (1996) Adducin regulation. Definition of the calmodulin-binding domain and sites of phosphorylation by protein kinases A and C. J. Biol. Chem., Oct 11; 271(41): 25157-66.

100. Mattson M.P., h ap. (1989) Development and selective neurodegeneration in cell cultures from different hippocampal regions. Brain Res., Jun 19; 490(1): 110-25.

101. Meador W.E., Means A.R., Quiocho F.A. (1993) Modulation of calmodulin plasticity in molecular recognition on the basis of x-ray structures. Science, Dec 10; 262(5140): 1718-21.

102. Means, A.R. (1988) Molecular mechanisms of action of calmodulin. Recent Prog Horm Res. 1988; 44: 223-62. Review.

103. Meiri K.F., и др. (1990) GAP-43 in growth cones is associated with areas of membrane that are tightly bound to substrate and is a component of a membrane skeleton subcellular fraction. J. Neurosci. Jan; 10(1): 256-66.

104. Mercer J.A., Seperack P.K., Strobel M.C., Copeland N.G., Jenkins N.A. (1991) Novel myosin heavy chain encoded by murine dilute coat colour locus. Nature. 1991 Feb 21; 349(6311): 709-713

105. И.Б.Мерцалов, Э.Гундельфингер, В.И.Цетлин. (1996) Клонирование кДНК нейрогранина человека. Биоорганическая химия, том 22, № 5, с. 366-369.

106. И.Б.Мерцалов, М.Штумм, П.Викер, С. том Дик, Э.Гундельфингер, В.И.Цетлин. Структура и хромосомная локализация гена нейрогранина человека. Биоорганическая химия, 1997, том 23, № 12, с. 961-968.

107. Miao Н.Н., Ye J.S., Wong S.L., Wang B.X., Li X.Y., Sheu F.S. (2000) Oxidative modification of neurogranin by nitric oxide: an amperometric study. Bioelectrochemistry, Jun; 51(2): 163-73

108. Miller R. (1988) Calcium signalling in neurons. Trends Neurosci. 11:415-419.

109. Mori N., Shoenherr C., Vandenbergh D.J., and Anderson D.J. (1992) A common silencer element in the SCG10 and type II Na+ channel genes binds a factor present in nonneuronal cells but not in neuronal cells. Neuron. 1992 Jul; 9(1): 45-54.

110. Morte В., Martinez de Arrieta C., Manzano J., Coloma A., Bernal J. (1999) Identification of a cis-acting element that interferes with thyroid hormone induction of the neurogranin (NRGN) gene. FEBS Lett., Dec 31; 464(3): 179-83

111. Morte B, Iniguez MA, Lorenzo PI, Bernal J. (1997) Thyroid hormone-regulated expression of RC3/neurogranin in the immortalized hypothalamic cell line GT1-7. J. Neurochem., Sep; 69(3): 902-9

112. Moss D.J., h flp. (1990) Chicken growth-associated protein GAP-43 is tightly bound to the actin-rich neuronal membrane skeleton. J. Neurochem., Mar; 54(3): 729-36.

113. Munoz A., Rodriguez-Pena A., Perez-Castillo A., Ferreiro B., Sutcliffe J.G., Bernal J. (1991) Effects of neonatal hypothyroidism on rat brain gene expression. Mol. Endocrinol., Feb;5(2):273-80.

114. Neve R.L., h ap. (1987) The neuronal growth-associated protein GAP-43 (B-50, Fl): neuronal specificity, developmental regulation and regional distribution of the human and rat mRNAs. Brain Res., Jul; 388(2): 177-83.

115. Neel V.A., Young M.W. (1994) Igloo, a GAP-43-related gene expressed in the developing nervous system of Drosophila. Development., Aug; 120(8): 2235-43.

116. Neuner-Jehle M., Denizot J.P., Mallet J. (1996) Neurogranin is locally concentrated in rat cortical and hippocampal neurons. Brain Res., Sep 9; 733(1): 149-54

117. Nicoll R.A., h ap. (1988) The current excitement in long-term potentiation. Neuron., Apr;l(2):97-103. Review.

118. Nielander H.B., h ap. (1993) Structure of the human gene for the neural phosphoprotein B-50 (GAP-43). Brain Res. Mol. Brain Res., Sep; 19(4): 293-302.

119. Olds J.L., Alkon D.L. (1991) A role for protein kinase C in associative learning. New Biol., Jan; 3(1): 27-35. Review.

120. Oneil K.T., DeGrado W.F. (1990) How calmodulin binds its targets: sequence independent recognition of amphiphilic a-helices. TIBS, 15 Feb., 59-64.

121. Ortoft E., Pahlman S., Andersson G., et al. (1993) Human GAP-43 gene expression: multiple start sites for initiation in differentiating human neuroblastoma cells. Molecular and Cellular Neurosciences, 4, 549-561.

122. Pasinelli P., Ramakers G.M., Urban I.J., Hens J.J., Oestreicher A.B., de Graan P.N., Gispen W.H. (1995) Long-term potentiation and synaptic protein phosphorylation. Behav. Brain. Res., Jan 23; 66(1-2): 53-9

123. Persechini A., Moncrief N., and Kretsinger R. (1989) The EF-hand family of calcium-modulated proteins. Trends Neurosci. 12: 462-467.

124. Petrova T.V., Takagi T., and Cox J. A. (1996) Phosphorylation of the IQ domain regulates the interaction between Ca-vector protein and its target in Amphioxus. J. Biol. Chem., 271, 26646-26652.

125. Piosik PA, van Groenigen M, Baas F. (1996) Effect of thyroid hormone deficiency on RC3/neurogranin mRNA expression in the prenatal and adult caprine brain. Brain Res. Mol. Brain Res., Dec; 42(2): 227-35

126. Piosik P.A., van Groenigen M., Ponne N.J., Bolhuis P.A., Baas F. (1995) RC3/neurogranin structure and expression in the caprine brain in relation to congenital hypothyroidism. Brain Res. Mol. Brain Res., Mar; 29(1): 119-30

127. Prichard L., Deloulme J.C., Storm D.R. (1999) Interactions between neurogranin and calmodulin in vivo. J. Biol. Chem., Mar 19; 274(12): 7689-94

128. Quackenbush J., et al. (1995) An STS content map of human chromosome 11: localization of 910 YAC clones and 109 islands. Genomics 29, 512-525.

129. Ramakers G.M., Gerendasy D.D., de Graan P.N. (1999) Substrate phosphorylation in the protein kinase Cgamma knockout mouse. J. Biol. Chem., Jan 22;274(4).T 873-4

130. Ramakers G.M., Heinen K., Gispen W.H., de Graan P.N. (2000) Long term depression in the CA1 field is associated with a transient decrease in pre- and postsynaptic PKC substrate phosphorylation. J. Biol. Chem., Sep 15; 275(37): 28682-7

131. Reinhard E., n /ip. (1994) Neural selective activation and temporal regulation of a mammalian GAP-43 promoter in zebrafish. Development. Jul; 120(7): 1767-75

132. Represa A., Deloulme J.C., Sensenbrenner M., Ben-Ari Y., Baudier J. (1990) Neurogranin: immunocytochemical localization of a brain-specific protein kinase C substrate. J Neurosci Dec; 10(12): 3782-92

133. Rhee S.G., Suh P.G., Ryu S.H., and Lee S.Y. (1989) Studies of inositol phospholipid-specific phospholipase C. Science 244: 546-550.

134. Rhoads A.R. and Friedberg F., (1997) Sequence motifs for calmodulin recognition. FASEB, v. 11,331-339.

135. Rodriguez-Sanchez P., Tejero-Diez P., Diez-Guerra F.J. (1997) Glutamate stimulates neurogranin phosphorylation in cultured rat hippocampal neurons. Neurosci. Lett., Jan 17; 221(2-3): 137-40

136. Routtenberg A. (1995 ) Knockout mouse fault lines. Nature., Mar 23; 374(6520): 314-5.

137. Ruiz-Marcos A., Cartagena Abella P., Garcia Garcia A., Escobar del Rey F., Morreale de Escobar G. (1988) Rapid effects of adult-onset hypothyroidism on dendritic spines of pyramidal cells of the rat cerebral cortex. Exp. Brain Res., 73(3): 583-8.

138. Ryu S.H., Lee S.Y., Lee K.Y., Rhee S.G. (1987) Catalytic properties of inositol trisphosphate kinase: activation by Ca2+ and calmodulin. FASEB J., Nov; 1(5): 388-93.

139. Sambrook J., Fritsch E.F., Maniatis T. (1989) Molecular Cloning: A laboratory manual. N.Y.: Cold Spring Harbor.

140. Sangameswaran L., and Morgan J.I. (1993) Structure and regulation of the gene encoding the neuron-specific protein PEP-19. Brain Res Mol Brain Res. 1993 Jul;19(l-2): 6268.

141. Sangameswaran L., h up. (1989) Molecular cloning of a neuron-specific transcript and its regulation during normal and aberrant cerebellar development. Proc. Natl. Acad. Sci. U S A., Jul; 86(14): 5651-5.

142. Sato T., Xiao D.M., Li H., Huang F.L., Huang K.P. (1995) Structure and regulation of the gene encoding the neuron-specific protein kinase C substrate neurogranin (RC3 protein).

143. J. Biol. Chem., Apr 28; 270(17): 10314-22

144. Sap J., de Magistris L., Stunnenberg H., Vennstrom B. (1990) A major thyroid hormone responsive element in the third intron of the rat growth hormone gene. EMBO J., 9: 887-896.

145. Seki K., Chen H.C., Huang K.P. (1995) Dephosphorylation of protein kinase C substrates, neurogranin, neuromodulin, and MARCKS, by calcineurin and protein phosphatases 1 and 2A. Arch. Biochem. Biophys., Feb 1; 316(2): 673-9

146. Skene JH. (1989) Axonal growth-associated proteins. Annu. Rev. Neurosci., 12: 127-56. Review.

147. Smith M.L., Johanson R.A., Rogers K.E., Coleman P.D., Slemmon J.R. (1998) Identification of a neuronal calmodulin-binding peptide, CAP-19, containing an IQ motif. Brain Res. Mol. Brain Res., Nov 12; 62(1): 12-24

148. Smith S., and Augustine G. (1988) Calcium ions, active zones and synaptic transmitter release. Trends Neurosci. 11: 458-464.

149. Shain D.H., h ap. (1995) Cloning and embryonic expression of Xenopus laevis GAP-43 (XGAP-43). Brain Res., Oct 30; 697(1-2): 241-6.

150. Sheu F.S., Mahoney C.W., Seki K., Huang K.P. (1996) Nitric oxide modification of rat brain neurogranin affects its phosphorylation by protein kinase C and affinity for calmodulin. J. Biol. Chem., Sep 13; 271(37): 22407-13

151. Schwanbeck R. and Wisniewski J.R. (1997) Cdc2 and mitogen-activated protein kinases modulate DNA-binding properties of the putative transcriptional regulator Chironomus high mobility group protein I. J. Biol. Chem. 272, 27476-27483.

152. Strittmatter S.M., h AP- (1995) Neuronal pathfinding is abnormal in mice lacking the neuronal growth cone protein GAP-43. Cell., Feb 10; 80(3): 445-52.

153. Strittmatter S.M., h (1990) GO is a major growth cone protein subject to regulation by GAP-43. Nature., Apr 26; 344(6269): 836-41.

154. Sudo Y., h ap. (1992) Palmitoylation alters protein activity: blockade of G(o) stimulation by GAP-43. EMBO J., Jun; 11(6): 2095-102.

155. Tallant E.A., Cheung W.Y. (1984) Characterization of bovine brain calmodulin-dependent protein phosphatase. Arch. Biochem. Biophys., Jul; 232(1): 269-79.

156. Taniguchi H., h jjp. (1994) A mass spectrometric study on the in vivo posttranslational modification of GAP-43. J. Biol. Chem., Sep 9; 269(36): 22481-4.

157. Thiel G., Greengard P., and Sudhof T.C. (1991) Characterization of tissue-specific transcription by the human synapsin I gene promoter. Proc Natl Acad Sci USA. 1991 Apr 15;88(8):3431-5.

158. Tsien R.W., Lipscomble D., Madison D., Bley K., and Fox A. (1988) Multiple types of neuronal calcium channels and their selective modulation. Trends Neurosci. 11: 431 -438.

159. Tsien R.W. and Tsien R.Y. (1990) Calcium channels, stores and oscillations. Annu. Rev. Biol. 6: 715-760.

160. Umesomo K., Murakami K., Thompson C.C., Evans R.M. (1991) Direct repeats as selective response elements for the thyroid hormone , retinoic acid and vitamin D receptors. Cell 65,1255-1266

161. Vanselow J., h AP- (1994) GAP-43 transgenic mice: dispersed genomic sequences confer a GAP-43-like expression pattern during development and regeneration. J. Neurosci., Feb; 14(2): 499-510.

162. Vibert M., Henry J., Kahn A., and Skala H. (1989) The brain-specific gene for rat aldolase C possesses an unusual housekeeping-type promoter. Eur J Biochem. 1989 Apr 15;181(1): 33-39.

163. Verhaagen J., h (1993) The rat B50 (GAP-43) promoter directs neuronal preferred expression of a reporter gene in Xenopus laevis embryos. Neuroscience Research Communications, # 2, 83-89.

164. Wang JH, Kelly PT. (1995) Postsynaptic injection of CA2+/CaM induces synaptic potentiation requiring CaMKII and PKC activity. Neuron, Aug; 15(2): 443-52

165. Watson J.B., h ap. (1990) Subtractive cDNA cloning of RC3, a rodent cortex-enriched mRNA encoding a novel 78 residue protein. J. Neurosci. Res., Aug; 26(4): 397-408.

166. Watson J.B., Szijan I., Coulter P.M 2nd. (1994) Localization of RC3 (neurogranin) in rat brain subcellular fractions. Brain Res. Mol. Brain Res., Dec; 27(2): 323-8

167. Watson J.B., Sutcliffe J.G., Fisher R.S. (1992) Localization of the protein kinase C phosphorylation/calmodulin-binding substrate RC3 in dendritic spines of neostriatal neurons. Proc. Natl. Acad. Sci. U S A., Sep 15; 89(18): 8581-5

168. Widmer F., h flp. (1993) Phosphorylation-site mutagenesis of the growth-associated protein GAP-43 modulates its effects on cell spreading and morphology. J. Cell. Biol., Jan; 120(2): 50312.

169. Woolf C.J., h ap. (1992) Denervation of the motor endplate results in the rapid expression by terminal Schwann cells of.the growth-associated protein GAP-43. J. Neurosci., Oct; 12(10): 3999-4010.

170. Xie X., Harrison D.H., Schlichting I., Sweet R.M., Kalabokis V.N., Szent-Gyorgy A.G., and Cohen C. (1994) Structure and regulatory domain of scallop myosin 2,8 A resolution. Nature 368,306-312.

171. Yankner B.A., h (1990) Transfection of PC12 cells with the human GAP-43 gene: effects on neurite outgrowth and regeneration. Brain Res. Mol. Brain Res., Jan; 7(1): 39-44.

172. Ziai M.R., h ap. (1988) .An immunochemical analysis of the distribution of a brain-specific polypeptide, PEP-19. J. Neurochem., Dec; 51(6): 1771-6.

173. Zuber M.X., h jyp. (1989) A membrane-targeting signal in the amino terminus of the neuronal protein GAP-43. Nature., Sep 28; 341(6240): 345-8.1 т.п.н.1. X 8 Н И К в вп 8 К

174. В В Н К К эцХ в 8 1Ш111Р В Я К XрК!><36.3) X1. Гг7 рВ820.18X1. Т7 рВ821.18•X1. С'Г7 рКв(1.20) X1. Т7 рКЭД.20) X

175. Т7 рК8(37.1.|) Т7 рК8(42.5) рК8(43.3)рКЯ<42.7)

176. GACGACGACATTCTAGACATCCCGCTGGACGATCCCGGCGCCAACGCGGCCGCCGCCAAAATCCAGGCGAGTTTTCGGGG 92801. Smal (9331)

177. CCACATGGCGCGGAAGAAGATAAAGAGCGGAGAGCGCGGCCGGAAGGGCCCGGGCCCTGGGGGGCCTGGCGGAGCTGGGG 9360 Smal (9366)

178. Крыса -4129 бтссавсаассстбаавтссабсаа сства Человек -3564 о т с с лес ааас с т влт

179. Крыса -2919 втатттваа-ттбтбавтбтстствтсттсссаатстббвттствссттсстстстетсттттссссассттвааесстб втатттва ттвтбаствт ствтсттс са вв тстэссттсстстстбтсттттсс сасст авсств

180. Человек -2340 отатттвавтттствавтат—стбтсттстсатстсабестствссттсстстстбтсттттсстсасстсаваесств